Table 2
Oligonucleotide primer sequences of three measles virus genes used in the NIBSC study
| Gene | Designation | Position | Sequence (5′ →3′) |
| N | MV1/outer | 1198–1218 | TTAGGGCAAGAGATGGTAAGG |
| N | MV2/outer | 1609–1630 | GTTCTTCCGAGATTCCTGCCA |
| N | MV3/inner | 1248–1268 | AGCATCTGAACTCGGTATCAC |
| N | MV4/inner | 1480–1500 | AGCCCTCGCATCACTTGCTCT |
| M | MV13/outer | 3565–3584 | GCGACAGGAAGGATGAATGC |
| M | MV14/outer | 3832–3851 | GTTTGCGTTGAAAGACACTCC |
| M | MV15/inner | 3587–3603 | TATGTACATGTTTCTGC |
| M | MV16/inner | 3811–3829 | GTTGTTAGGACCTTTCTCC |
| H | MV-M3/outer | 8106–8125 | CAGTCAGTAATGATCTCAGC |
| H | MV-M6/outer | 8676–8701 | CTTGAATCTCGGTATCCACTCCAAT |
| H | MV-H7/inner | 8147–8171 | GAGCTCAAACTCGCAGCCCTTTGTC |
| H | MV-H4A/inner | 8457–8482 | ATCCTTCAATGGTGCCCACTCGGGA |
-
The nucleotide positions are in relation to the sequence reported for the measles virus genome in the EMBL-Genbank data under accession number K01711.
-
N, nucleocapsid protein gene; M, matrix protein gene; H, haemagglutinin protein gene.
