Gene | dbSNP | Change | Ref | Obs | P1 | P2 | P3 | P4 | P5 | P6 |
---|---|---|---|---|---|---|---|---|---|---|
MVK NM_000431.2 (Chr 12) | rs104895334 | c.16_34del; p.Leu6_Gly12delinsGlyfs | CCTACTGGTGTCTGCTCCGG | C | WT | WT | WT | HET | WT | WT |
rs104895336 | c.G394A; p.V132I | G | A | HET | WT | WT | WT | WT | WT | |
rs104895297 | c.C404T; p.S135L | C | T | WT | WT | HET | WT | WT | WT | |
rs104895304 | c.T803C; p.I268T | T | C | WT | WT | WT | WT | HET | WT | |
rs104895358 | c.G1006A; p.G336S | G | A | WT | WT | WT | WT | WT | HOM | |
rs28934897 | c.G1129A; p.V377I | G | A | HOM | HOM | HET | HET | HET | WT |
For each mutation, the following are shown: the respective identifier (dbSNP), the nucleotide substitution and, if present, the amino acid change (Change), the reference sequence (Ref) and the one observed (Obs). For each of the six patients (P1, P2, P3, P3, P4, P5, P6), the mutation is identified as wild-type (WT), heterozygous (HET) or homozygous (HOM).
MVK, mevalonate kinase.