The truncated metabolite GLP-2 (3–33) interacts with the GLP-2 receptor as a partial agonist

doi:10.1016/S0167-0115(01)00316-0

Regulatory Peptides

Volume 103, Issue 1, 15 January 2002, Pages 9-15

https://doi.org/10.1016/S0167-0115(01)00316-0 Get rights and content

Abstract

The therapeutic potential of the intestinotrophic mediator glucagon-like peptide-2 (1–33) [GLP-2 (1–33)] has increased interest in the pharmacokinetics of the peptide. This study was undertaken to investigate whether the primary degradation product GLP-2 (3–33) interacts with the GLP-2 receptor. Functional (cAMP) and binding in vitro studies were carried out in cells expressing the transfected human GLP-2 receptor. Furthermore, a biologic response of GLP-2 (3–33) was tested in vivo. Mice were allocated to groups treated for 10 days (twice daily) with: (1) 5 μg GLP-2 (1–33), (2) 25 μg GLP-2 (3–33), (3) 5 μg GLP-2 (1–33)+100 μg GLP-2 (3–33), or (4) 5 μg GLP-2 (1–33)+500 μg GLP-2 (3–33). The intestine was investigated for growth changes. GLP-2 (3–33) bound to the GLP-2 receptor with a binding affinity of 7.5% of that of GLP-2 (1–33). cAMP accumulation was stimulated with an efficacy of 15% and a potency more than two orders of magnitude lower than that of GLP-2 (1–33). Increasing doses of GLP-2 (3–33) (10⁻⁷–10⁻⁵ M) caused a shift to the right in the dose–response curve of GLP-2 (1–33). Treatment of mice with either GLP-2 (1–33) or (3–33) induced significant growth responses in both the small and large intestines, but the response induced by GLP-2 (3–33) was much smaller. Co-administration of 500 μg of GLP-2 (3–33) and 5 μg GLP-2 (1–33) resulted in a growth response that was smaller than that of 5 μg GLP-2 (1–33) alone. Consistent with the observed in vivo activities, our functional studies and binding data indicate that GLP-2 (3–33) acts as a partial agonist with potential competitive antagonistic properties on the GLP-2 receptor.

Introduction

Glucagon-like peptide-2 (GLP-2) is a 33-amino acid peptide that arises from tissue-specific processing of the glucagon precursor, proglucagon, within the mucosal L-cells and specific neurons located in the brainstem [1], [2], [3]. Although the exact physiologic role of GLP-2 is not fully elucidated, recent data have indicated that GLP-2 has intestinotrophic and anorectic effects [4], [5], [6], [7], [8]. GLP-2 exerts its action through binding to the GLP-2 receptor, a G-protein-coupled receptor most closely related to the glucagon-like peptide-1 (GLP-1) and glucagon receptors, which is linked to the activation of the adenylate cyclase pathway [9], [10]. The receptor appears to be predominantly expressed in the intestine and in the compact part of the dorsomedial hypothalamic nucleus [8], [9], [11], [12].

Recently, a potential therapeutic role for GLP-2, based on its intestinotrophic effects, was demonstrated in patients with short bowel syndrome [13] and this pharmacologic potential of the peptide has increased interest in its pharmacokinetics of GLP-2. In vivo, intact GLP-2 (1–33) is degraded from its NH₂-terminal by cleavage of two amino acids by the widely distributed serine protease dipeptidyl peptidase IV (DPP-IV), producing the truncated fragment GLP-2 (3–33) [14], [15], [16]. This cleavage of a dipeptide from GLP-2 (1–33) might be crucial for the peptide's biologic activities, since previous studies with GLP-2 and other members of the proglucagon-derived peptides (PGDPs), i.e. GLP-1, have suggested that the NH₂-terminal is important for signal transduction, whereas the C-terminus seems to be more important for the correct folding of the peptide [9], [17], [18]. Concordant with this, recent data have indicated that the truncated fragment, GLP-2 (3–33), interacts with the GLP-2 receptor [9], [12], but it remains unclear whether GLP-2 (3–33) possesses in vivo activity per se or has any influence on the biologic activity of GLP-2 (1–33), e.g. by competitive interaction.

In the present study, baby hamster kidney (BHK) cells transfected with the gene coding for the human GLP-2 receptor were used to investigate fundamental properties of GLP-2 (1–33) and GLP-2 (3–33) receptor interactions. Furthermore, treatment of mice with GLP-2 (3–33) was conducted in order to investigate whether the metabolite per se induced a growth response in the intestine or interfered with the GLP-2 (1–33)-mediated intestinal effects.

Section snippets

GLP-2 receptor assays

The DNA coding for the human GLP-2 receptor was cloned by PCR on cDNA from small intestine (Clontech cat. #7426-1, Palo Alto, USA), based upon the sequence by Munroe et al [9]. The primers used were AAAAACTCGAGACCATGAAGCTGGGATCGAGCAGGGC and AAAAAGAATTCTAGATCTCACTCTCTTCCAGAATC, providing the gene with a XhoI site at the 5′ end and an EcoRI site at the 3′ end. The sequence was verified and the gene was inserted into pcDNA3.1 (Invitrogen, Groningen, The Netherlands). It was then stably transfected

GLP-2 receptor assays

The functional receptor assay with transfected BHK cells was carried out by measuring cAMP as a response to stimulation by GLP-2 (1–33) or GLP-2 (3–33). GLP-2 (1–33) acted as a potent agonist with an EC₅₀ of 31±6 pM (n=4) (Fig. 1a). GLP-2 (3–33) stimulated only sparse activity (approximately 15% efficacy compared to GLP-2 (1–33)) and had an EC₅₀ of 5800±850 pM. The GLP-2 assay was specific against the closely related peptides GLP-1, glucagon, and glucose-dependent insulinotrophic peptide (GIP).

Discussion

The present data suggest that the truncated metabolite GLP-2 (3–33) interacts with the human GLP-2 receptor as a partial agonist with competitive antagonistic properties. This conclusion is based on four lines of evidence: (1) GLP-2 (3–33) stimulates cAMP production with an efficacy of approximately 15% in BHK cells transfected with the gene encoding for the human GLP-2 receptor; (2) increasing concentrations of GLP-2 (3–33) cause a shift to the right in the dose–response curves for GLP-2

Acknowledgements

The authors gratefully acknowledge the technical assistance of Else Hansen, Grazyna Poulsen, Tania Rasmussen, Sine Rosenfalck, and Jette Schousboe. This study was supported by grants from The Danish Biotechnology Centre for Signal-peptide Research, The Danish Medical Research Council, The Danish Medical Association Research Fund, and The Novo Nordisk Foundation.

References (32)

P.J. Larsen et al.
Distribution of glucagon-like peptide-1 and other preproglucagon-derived peptides in the rat hypothalamus and brainstem
Neuroscience
(1997)
B. Hartmann et al.
Structure, measurement, and secretion of human glucagon-like peptide-2
Peptides
(2000)
B. Yusta et al.
Identification of glucagon-like peptide-2 (GLP-2)-activated signaling pathways in baby hamster kidney fibroblasts expressing the rat GLP-2 receptor
J. Biol. Chem.
(1999)
B. Yusta et al.
Enteroendocrine localization of GLP-2 receptor expression in humans and rodents
Gastroenterology
(2000)
J. Thulesen et al.
Potential targets for glucagon-like peptide 2 (GLP-2) in the rat: distribution and binding of i.v. injected (125)I-GLP-2
Peptides
(2000)
P.B. Jeppesen et al.
Glucagon-like peptide 2 improves nutrient absorption and nutritional status in short-bowel patients with no colon
Gastroenterology
(2001)
K. Adelhorst et al.
Structure-activity studies of glucagon-like peptide-1
J. Biol. Chem.
(1994)
J.F. Thorell et al.
Enzymatic iodination of polypeptide with (125I) to high specific activity
Biochim. Biophys. Acta
(1971)
R. Mentlein
Proline residues in the maturation and degradation of peptide hormones and neuropeptides
FEBS Lett.
(1988)
J.J. Holst
Enteroglucagon
Annu. Rev. Physiol.
(1997)

D.J. Drucker et al.

Induction of intestinal epithelial proliferation by glucagon-like peptide 2

Proc. Natl. Acad. Sci. U. S. A.

(1996)

C.H. Tsai et al.

Intestinal growth-promoting properties of glucagon-like peptide-2 in mice

Am. J. Physiol.

(1997)

C.H. Tsai et al.

Biological determinants of intestinotrophic properties of GLP-2 in vivo

Am. J. Physiol.

(1997)

B. Hartmann et al.

Dipeptidyl peptidase IV inhibition enhances the intestinotrophic effect of glucagon-like peptide-2 in rats and mice

Endocrinology

(2000)

M. Tang-Christensen et al.

The proglucagon-derived peptide, glucagon-like peptide-2, is a neurotransmitter involved in the regulation of food intake

Nat. Med.

(2000)

D.G. Munroe et al.

Prototypic G protein-coupled receptor for the intestinotrophic factor glucagon-like peptide 2

Proc. Natl. Acad. Sci. U. S. A.

(1999)

Cited by (70)

Long-acting agonists of human and rodent GLP-2 receptors for studies of the physiology and pharmacological potential of the GLP-2 system
2023, Biomedicine and Pharmacotherapy
Glucagon-like peptide-2 (GLP-2) is secreted postprandially from enteroendocrine Lcells and has anabolic action on gut and bone. Short-acting teduglutide is the only approved GLP-2 analog for the treatment of short-bowel syndrome (SBS). To improve the therapeutic effect, we created a series of lipidated GLP-2R agonists.
Six GLP-2 analogs were studied in vitro for cAMP accumulation, β-arrestin 1 and 2 recruitment, affinity, and internalization. The trophic actions on intestine and bone were examined in vivo in rodents.
Lipidations at lysines introduced at position 12, 16, and 20 of hGLP-2(1−33) were well-tolerated with less than 2.2-fold impaired potency and full efficacy at the hGLP-2R in cAMP accumulation. In contrast, N- and C-terminal (His1 and Lys30) lipidations impaired potency by 4.2- and 45-fold and lowered efficacy to 77% and 85% of hGLP-2, respectively. All variants were similarly active on the rat and mouse GLP-2Rs and the three most active variants displayed increased selectivity for hGLP-2R over hGLP-1R activation, compared to native hGLP-2. Impact on arrestin recruitment and receptor internalization followed that of Gαs-coupling, except for lipidation in position 20, where internalization was more impaired, suggesting desensitization protection. A highly active variant (C16 at position 20) with low internalization and a half-life of 9.5 h in rats showed improved gut and bone tropism with increased weight of small intestine in mice and decreased CTX levels in rats.
We present novel hGLP-2 agonists suitable for in vivo studies of the GLP-2 system to uncover its pharmacological potential.
Glucagon-Like Peptide-2 Stimulates S-Phase Entry of Intestinal Lgr5+ Stem Cells
2022, Cellular and Molecular Gastroenterology and Hepatology
Citation Excerpt :
Lgr5-eGFP-IRES-creERT2 mice were treated with hGly2–GLP-2 (0.2 mg/kg body weight; American Peptide Company, Sunnyvale, CA) or phosphate-buffered saline (pH 7.4, vehicle) subcutaneously 6 and 3 hours before being killed, or with 30 ng human GLP-23–33 or vehicle intraperitoneally 3.5 hours before being killed. As previously reported, GLP-23–33 is a partial agonist of the GLP-2R.12,47 Hence, at very high concentrations, GLP-23–33 can partially activate GLP-2R signaling.
Leucine-rich repeat-containing G-protein–coupled receptor-5 (Lgr5)+/olfactomedin-4 (Olfm4)+ intestinal stem cells (ISCs) in the crypt base are crucial for homeostatic maintenance of the epithelium. The gut hormone, glucagon-like peptide-2^1–33 (GLP-2), stimulates intestinal proliferation and growth; however, the actions of GLP-2 on the Lgr5+ ISCs remain unclear. The aim of this study was to determine whether and how GLP-2 regulates Lgr5+ ISC cell-cycle dynamics and numbers.
Lgr5-Enhanced green-fluorescent protein - internal ribosome entry site – Cre recombinase – estrogen receptor T2 (eGFP-IRES-creERT2) mice were acutely administered human Glycine² (Gly2)-GLP-2, or the GLP-2–receptor antagonist, GLP-2^3–33. Intestinal epithelial insulin-like growth factor-1–receptor knockout and control mice were treated chronically with human Gly2 (hGly2)–GLP-2. Cell-cycle parameters were determined by 5-Ethynyl-2'-deoxyuridine (EdU), bromodeoxyuridine, antibody #Ki67, and phospho-histone 3 labeling and cell-cycle gene expression.
Acute hGly2–GLP-2 treatment increased the proportion of eGFP+EdU+/OLFM4+EdU+ cells by 11% to 22% (P < .05), without affecting other cell-cycle markers. hGly2–GLP-2 treatment also increased the ratio of eGFP+ cells in early to late S-phase by 97% (P < .001), and increased the proportion of eGFP+ cells entering S-phase by 218% (P < .001). hGly2–GLP-2 treatment induced jejunal expression of genes involved in cell-cycle regulation (P < .05), and increased expression of Mcm3 in the Lgr5-expressing cells by 122% (P < .05). Conversely, GLP-2^3–33 reduced the proportion of eGFP+EdU+ cells by 27% (P < .05), as well as the expression of jejunal cell-cycle genes (P < .05). Finally, chronic hGly2–GLP-2 treatment increased the number of OLFM4+ cells/crypt (P < .05), in an intestinal epithelial insulin-like growth factor-1–receptor–dependent manner.
These findings expand the actions of GLP-2 to encompass acute stimulation of Lgr5+ ISC S-phase entry through the GLP-2R, and chronic induction of Lgr5+ ISC expansion through downstream intestinal insulin-like growth factor-1 signaling.
GLP-2 decreases food intake in the dorsomedial hypothalamic nucleus (DMH) through Exendin <inf>(9–39)</inf> in male Sprague-Dawley (SD) rats
2021, Physiology and Behavior
Glucagon-like peptide 2 (GLP-2), a member of Glucagon peptide family involved in regulating energy metabolism, can be produced and secreted by preproglucagonergic (PPG) neurons in the brain. GLP-2 reduces food intake but at which brain sites GLP-2 exerts its feeding-suppress effects are still unclear. In this study, we used the stereological microinjection technique and behavioral test to examine the functions of locally delivered GLP-2 into DMH on feeding behavior. We compared effects of different concentration of GLP-2 on the food intake behavior in free-feeding rats and fasted-refeeding rats. We found that GLP-2 inhibited food intake in fasted rats after a short-term intervention in a dose-dependent manner. Importantly, the effects of locally delivered GLP-2 can be blocked by specific GLP-1 receptor antagonist Exendin_(9–39), but not the melanocortin-4 receptor antagonist SHU9119, indicating the involvement of specificity of GLP-2 signaling in regulating the feeding behavior. Taken together, our data revealed that GLP-2 peptide pharmacologically inhibited food intake in DMH and this effect could be blocked functionally by Exendin_(9–39).
Molecular interactions of full-length and truncated GIP peptides with the GIP receptor – A comprehensive review
2020, Peptides
Enzymatic cleavage of endogenous peptides is a commonly used principle to initiate, modulate and terminate action for instance among cytokines and peptide hormones. The incretin hormones, glucose-dependent insulinotropic polypeptide (GIP) and glucagon-like peptide-1 (GLP-1), and the related hormone glucagon-like peptide-2 (GLP-2) are all rapidly N-terminally truncated with severe loss of intrinsic activity. The most abundant circulating form of full length GIP(1–42) is GIP(3–42) (a dipeptidyl peptidase-4 (DPP-4) product). GIP(1–30)NH₂ is another active form resulting from prohormone convertase 2 (PC2) cleavage of proGIP. Like GIP(1–42), GIP(1–30)NH₂ is a substrate for DPP-4 generating GIP(3–30)NH₂ which, compared to GIP(3–42), binds with higher affinity and very efficiently inhibits GIP receptor (GIPR) activity with no intrinsic activity. Here, we review the action of these four and multiple other N- and C-terminally truncated forms of GIP with an emphasis on molecular pharmacology, i.e. ligand binding, subsequent receptor activation and desensitization. Our overall conclusion is that the N-terminus is essential for receptor activation as GIP N-terminal truncation leads to decreased/lost intrinsic activity and antagonism (similar to GLP-1 and GLP-2), whereas the C-terminal extension of GIP(1–42), as compared to GLP-1, GLP-2 and glucagon (29–33 amino acids), has no apparent impact on the GIPR in vitro, but may play a role for other properties such as stability and tissue distribution. A deeper understanding of the molecular interaction of naturally occurring and designed GIP-based peptides, and their impact in vivo, may contribute to a future therapeutic targeting of the GIP system – either with agonists or with antagonists, or both.
G protein-coupled receptor 40 activation ameliorates dextran sulfate sodium-induced colitis in mice via the upregulation of glucagon-likepeptide-2
2019, Journal of Pharmacological Sciences
Citation Excerpt :
Likewise, this agonist showed the tendency to attenuate the DSS-induced upregulation of IL-1β and IL-6; however, the difference was not statistically significant (Fig. 2C, D). We investigated the effects of the GPR40 antagonist DC26012624 and the GLP-2 antagonist GLP-2 (3-33)25,26 on the AS2034178-induced improvement of DSS-induced colitis. GLP-2 (3-33) acts as a partial antagonist for GLP-2 receptors to attenuate the responses to exogenous GLP-2 in cell experiments in vitro and in mice in vivo.25
G protein-coupled receptor (GPR) 40 is a receptor for long-chain free fatty acids that enhances glucagon-like peptide (GLP)-2 production in intestinal L-cells. GLP-2 and its analogs have reported to increase remission rates in patients with Crohn's disease and improve experimental colitis in rodents. In the present study, we investigated the ameliorative effect of GPR40 activation in a dextran sulfate sodium (DSS)-induced murine colitis model using a specific GPR40 agonist, AS2034178. The daily administration of AS2034178 attenuated DSS-induced increases in the disease activity index, the shortening of the colon length, and the histological colonic injury, and increased the myeloperoxidase (MPO) activity and expression of inflammatory cytokines, in a dose-dependent manner. These effects were abolished by treatment with DC260126, a GPR40 antagonist, or GLP-2 (3-33), a GLP-2 antagonist. GPR40 was expressed in the colonic mucosa, which was colocalized with proglucagon, a precursor of GLP-2. AS2034178 significantly increased the amount of GLP-2 in the colonic tissue, which was abolished by DC260126 but not GLP-2 (3-33). Furthermore, AS2034178 significantly promoted the healing of DSS-induced colitis. These findings suggest that GPR40 activation ameliorates DSS-induced colitis in mice by enhancing GLP-2 production. Thus, GPR40 is a potential target for the treatment of IBD.
Glucagon like peptide 2 (GLP-2)
2018, Encyclopedia of Endocrine Diseases
The role of the gastrointestinal (GI) tract in energy homeostasis through the digestion and absorption of carbohydrates, and the production of incretin hormones remains well recognized in recent years. Studying the functional changes of the GI system following bariatric surgery, particularly involving the secretion of incretin hormones has led into understanding their interaction with areas of the brain to regulate metabolism and energy balance. In Type 2 Diabetes Mellitus (T2DM) and obesity, this homeostatic balance is disrupted, either through alterations in the levels of these hormones or through resistance to their actions. Although bariatric surgery is an effective treatment for T2DM and obesity, it cannot be applied to most patients. Hence, recapitulation of the changes of incretin hormone secretion after bariatric surgery in the post Glucagon-like peptide 1 (GLP-1) analogue era remains an attractive area for further research and the development of new treatments for T2DM and obesity.
Glucagon-like peptide 2 (GLP-2) is a proglucagon-derived peptide produced by intestinal L-cells and by cells within the brainstem and other areas of the central nervous system. GLP-2 is implicated in regulation of energy absorption and maintenance of GI mucosal structure but as recent evidence suggests may also have a beneficial effect in glucose homeostasis, particularly in states associated with increased energy uptake such as obesity.

View all citing articles on Scopus

View full text

The truncated metabolite GLP-2 (3–33) interacts with the GLP-2 receptor as a partial agonist

Abstract

Introduction

Section snippets

GLP-2 receptor assays

GLP-2 receptor assays

Discussion

Acknowledgements

Neuroscience

Peptides

J. Biol. Chem.

Gastroenterology

Peptides

Gastroenterology

J. Biol. Chem.

Biochim. Biophys. Acta

FEBS Lett.

Enteroglucagon

Annu. Rev. Physiol.

Induction of intestinal epithelial proliferation by glucagon-like peptide 2

Proc. Natl. Acad. Sci. U. S. A.

Intestinal growth-promoting properties of glucagon-like peptide-2 in mice

Am. J. Physiol.

Biological determinants of intestinotrophic properties of GLP-2 in vivo

Am. J. Physiol.

Dipeptidyl peptidase IV inhibition enhances the intestinotrophic effect of glucagon-like peptide-2 in rats and mice

Endocrinology

The proglucagon-derived peptide, glucagon-like peptide-2, is a neurotransmitter involved in the regulation of food intake

Nat. Med.

Prototypic G protein-coupled receptor for the intestinotrophic factor glucagon-like peptide 2

Proc. Natl. Acad. Sci. U. S. A.