TISSUE SAMPLES

Surgical specimens derived from involved areas of the large intestine of 10 patients with active CD were studied. CD was active in all patients, as confirmed by clinical features, laboratory parameters, as well as macroscopic and histopathological alterations. All patients underwent surgical intervention because of failure of medical treatment. As controls, surgical specimens from the gut of five patients suffering from therapy resistant ulcerative colitis (UC) (table 1) as well as macroscopic and microscopic uninvolved large bowel tissues from five patients with non-inflammatory gut disorder (NIGD) were used (three colon carcinoma and two diverticular disease). For routine morphological analysis, immunohistochemistry, and non-radioactive in situ hybridisation, appropriate tissue specimens were fixed in formalin and embedded in paraffin. Additional representative samples were snap frozen in liquid nitrogen, stored at −80°C, and used for RNA isolation.

RNA EXTRACTION AND REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION (RT-PCR)

RNA was isolated from cryoconserved tissue samples using TriReagent according to the manufacturer's instructions (Sigma, Deisenhofen, Germany) and finally obtained in 30 μl RNase free water. RNA content was determined spectrophotometrically. RNA (1 μg) was used for reverse transcription after a DNase (FPLC-pure DNaseI; Pharmacia, Freiburg, Germany) digestion step. cDNA synthesis was performed in a total volume of 20 μl RNase free water including 1.5 μM oligo-dT primer, 0.4 mM of each deoxynucleotidetriphosphate (both MBI Fermentas, St Leon-Rot, Germany), and 200 U of reverse transcriptase (SuperScriptII; Gibco, Karlsruhe, Germany).

The oligonucleotide primer sequences were determined manually according to the published sequences in GenBank for β-actin (X00351) and IL-16 (M90391). Polymerase chain reaction (PCR) conditions were as follows: β-actin (β-actin-fw-primer: 5′- CTA CAATGAGCTGCGTGTGGC-3′; β-actin -rev-primer: 5′-CAGGTCCAGACGCAGGAT GGC -3′; product size: 270 bp) three minutes at 95°C, 35 cycles of 40 seconds at 95°C, 45 seconds at 57°C, 1.5 minutes at 72°C, followed by a final extension step of seven minutes at 72°C; IL-16 (IL-16-fw-primer: 5′- ATG CCCGACCTCAACTCCTCCACT -3′; IL-16-rev-primer: 5′-GCCACCCAGCTGC AAGATTTC -3′; product size: 261 bp) three minutes at 95°C, 35 cycles of 40 seconds at 95°C, 40 seconds at 62°C, one minute at 72°C, and final elongation of seven minutes at 72°C. The PCR products were visualised on 1% agarose gels by staining with ethidium bromide. To exclude amplification of genomic sequences, PCR primers were designed to amplify cDNA fragments that span at least one intron of the corresponding gene. cDNA from a human lymph node was used as a positive control template for each primer pair. Negative controls with water instead of cDNA were always included. A PCR reaction was considered to be positive when a single band of correct product length could be detected. Amplification of correct PCR products was controlled by asymmetric restriction enzyme digestion and sequencing with an ABI310 automatic sequencer using the rhodamine-dye-terminator kit according to the manufacturer's instructions (Perkin Elmer, Darmstadt-Weiterstadt, Germany).

CLONING OF PCR PRODUCTS

For generation of the IL-16 riboprobe for quantitative real time RT-PCR or in situ hybridisation, PCR products were cloned into the blunt end SmaI restriction site of the transcription vector pBluescript II KS plasmid. Briefly, blunt end PCR products were generated using Vent polymerase (Pharmacia) according to the PCR cycling conditions, as mentioned above. After micro spin column purification (Pharmacia, Heidelberg, Germany), the blunt end PCR products were ligated into a SmaI restricted pBluescript II KS plasmid using T4-DNA-ligase at 16°C overnight and transformed into the CaCl₂ competentEscherichia coli strain DH5α. After propagation under standard culture conditions the plasmids were isolated using the alkaline lysis procedure. Cloning of IL-16 specific PCR fragments was confirmed by cycle sequencing with the rhodamine-dye-terminator kit using an ABI 310 sequencer according to the manufacturer's instructions (Perkin-Elmer). Riboprobes were generated by in vitro transcription using T3 or T7 polymerase (Boehringer, Mannheim, Germany). The amount of cRNA transcripts was monitored by 1% agarose gel electrophoresis and determined spectrophoto- metrically.

REAL TIME QUANTITATIVE RT-PCR ANALYSIS

Quantification of IL-16 mRNA expression by RT-PCR was performed on an iCycler iQ real time detection system (Bio-Rad, Hercules, California, USA). For RT-PCR, a one step RT-PCR kit (Qiagen, Hilden, Germany) was used. The 15 μl reaction from this kit was supplemented with 150 ng total cellular RNA, 0.6 μM each of the gene specific primers, 4 U RNase inhibitor (Promega, Mannheim, Germany), and 0.5 μl of SYBRgreen I dye (Molecular Probes, MoBiTec, Göttingen, Germany), and diluted in 1× RT-PCR buffer (Qiagen) to 12.5×. Dilution was checked spectrophotometrically at 260 nm. The final concentration of SYBRgreen I dye was 0.4×. The reaction mix was loaded into rows of eight 200 μl PCR reaction tubes (Sarstedt, Nümbrecht, Germany) and covered with optical sealing tape (Bio-Rad). The thermal cycling proceeded as follows: 50°C for 30 minutes reverse transcription followed by 15 minutes at 95°C for denaturation of reverse transcriptase and activation of HotStar Taq polymerase. A maximum of 50 PCR cycles were run in the following profile: initial denaturation at 95°C, annealing at 62°C, and extension at 72°C for 30 seconds each. Acquisition of fluorescence signals was monitored on the iCycler and terminated when all reactions reached an amplification plateau and template free control remained at baseline levels. A PCR standard curve was generated using the same reaction mix including in vitro generated IL-16 cRNA (dilution range from 1 to 1000 attomols) instead of total cellular RNA. Data analysis was performed with iCycler iQ real time detection system software (Bio-Rad). Results derived from the PCR standard curve for IL-16 mRNA expression are given in attomoles per μg total cellular RNA.

To verify that only specific PCR products evoked fluorescence signals, a melting curve of PCR products was obtained in a cycler programme of denaturation (95°C), renaturation (50°C), and a temperature ramp from 60°C to 95°C with 0.5°C increments for 10 seconds. Melting peaks were related to PCR product size on 1% agarose gels.

IMMUNOHISTOCHEMISTRY

Paraffin embedded sections were immunostained applying the biotin-streptavidin-peroxidase method according to the manufacturer's instructions (Dako, Hamburg, Germany). For detection of IL-16 (IgG1 hybridoma supernatant, gift from G Schluesener, Tübingen, Germany)18 and CD4 (Novocastra, Dossenheim, Germany), sections were pretreated by repeated boiling in citrate buffer (pH 6.1) in a microwave (700 W, 5×3 minutes). After cooling to room temperature, non-specific binding was blocked with 20% rabbit serum (CC-Pro, Frankfurt/Main, Germany) in 0.05 mol/l Tris/HCl buffer-NaCl solution (TBS, pH 7.4) followed by incubation with the primary antibody overnight at 4°C in a humidified chamber. After rinsing in TBS, slides were incubated for 30 minutes with a biotinylated rabbit antimouse Ig polyclonal antibody (Dako) followed by incubation with a streptavidin-biotin-complex coupled with horseradish peroxidase (Dako) for 20 minutes at room temperature. Peroxidase activity was visualised using diaminobenzidine as the chromogen. In control reactions primary antibodies were omitted.

To characterise in situ coexpression of IL-16 by CD4+ or CD8+ T cells and mast cells, dual colour digital confocal laser microscopy on paraffin embedded sections was performed. Pretreatment of the deparaffinised slides was performed as mentioned above. The IL-16 monoclonal antibody (mAb) was applied first and incubated overnight in a humidified chamber at 4°C followed by incubation with rhodamine-red-X conjugated F(ab) fragments of rabbit antimouse Ig (Dianova, Hamburg, Germany) at saturating concentrations for 60 minutes at room temperature. Subsequently, mAbs against CD4, CD8 (Novocastra), and tryptase (for characterisation of mast cells; Dako) were applied overnight at 4°C. For detection of tryptase the mAb was directly labelled with fluorescein isothiocyanate (FITC) using a FITC labelling kit according to the manufacturer's instructions (Boehringer). mAbs against CD4 and CD8 were detected by indirect immunofluorescence using F(ab)₂ fragments of indocarbocyanine 2 labelled goat antimouse immunoglobulins (Dianova) for 60 minutes at room temperature. After each incubation, sections were thoroughly washed in TBS and prior to examination embedded in fluoromount fluorescent mounting media to prevent fading (Dako). Omission of first step antibodies served as negative controls. Sections were analysed using the Leica (Heidelberg, Germany) TCS NT laser scanning system mounted on an Olympus Opticals (Tokyo, Japan) BX50 WI microscope.

IN SITU HYBRIDISATION

For in situ hybridisation, paraffin sections were mounted on slides coated with 3-aminopropyl-triethoxysilane (Sigma) under RNAse free conditions. Slides were dried at 37°C overnight.

Digoxigenin labelled cRNA probes were prepared using a kit, according to the manufacturer's instructions (Boehringer). Briefly, plasmids were linearised with NotI or HindIII, and digoxigenin-11-dUTP labelled antisense and sense probes were generated by in vitro transcription using T3 or T7 polymerase (Boehringer). The amount of transcripts was monitored by 1% agarose gel electrophoresis. Labelling efficiency was controlled by dot blot analysis of serial probe dilutions.

In situ hybridisation was performed according to the method of Breitschopf and colleagues.19 In brief, tissue sections were deparaffinised, rehydrated in serial dilutions of ethanol, and postfixed in 4% TBS buffered paraformaldehyde. Samples were permeabilised using proteinase K (10 μg/ml) for 30 minutes at 37°C. Digestion was stopped by washing the samples in phosphate buffered saline (pH 7.4). For blocking of endogenous alkaline phosphatase, slides were incubated with 0.25% acetic anhydride and dehydrated in serial dilutions of ethanol. Digoxigenin labelled riboprobes were diluted in hybridisation buffer (Amersham, Braunschweig, Germany). After application of sense or antisense probes, samples were covered with sterile coverslips and placed on a hot plate at 85°C for five minutes for probe and target denaturation. Hybridisation was performed overnight at 62°C in a sealed humidified chamber containing 50% formamide. Non-specific binding or unbound probes were removed by the following post-hybridisation washes: 1×SSC/0.1%SDS at room temperature (2×5 minutes) and 0.2×SSC/0.1%SDS at 60°C (2×10 minutes) followed by RNase digestion (20 μg/ml; Gibco, Karlsruhe, Germany) for 30 minutes at 37°C. Finally, sections were washed in TBS containing 0.1% Tween 20 (Boehringer).

Hybridisation signals were detected using a sheep polyclonal antibody F(ab)₂ fragment against digoxigenin conjugated with alkaline phosphatase (1:500; Boehringer). Alkaline phosphatase activity was visualised using 5-bromo-4-chloro-3-indolyl phosphate as substrate and nitroblue tetrazolium as coupler (Boehringer). For each tissue section sense riboprobes served as controls.

In some cases hybridised specimens were incubated with mAbs Ki-M1P recognising monocytes/macrophages,20 Ki-M4P recognising follicular dendritic cells (kindly provided by Professor MR Parwaresch, Kiel, Germany),21 CD3 for T cells, CD20 for B cells, NK-1 for natural killer cells, and S100 protein recognising interdigitating dendritic cells (Dako) followed by a rabbit antimouse Ig FITC (Dako) for evaluation by immunofluorescence.

COUNTING AND DATA ANALYSIS

Evaluation of immunoreactivity was performed on step sections stained for IL-16 and CD4 by two blinded evaluators. Corresponding areas of the step sections were marked and high power fields were counted with an eyepiece graticule at 400× magnification. The results were expressed as mean counts from a total of five high power fields per slide. The within observer coefficient of variation for repeated counts was less than 5%.

Data were analysed using a statistical package (Systat version 5.1; Systat Inc, Evanston, USA). Statistical comparisons were performed using ANOVA, and subsequent comparisons were made using the Mann-Whitney U test; p<0.05 was considered statistically significant. Correlation was performed using Spearman's rank correlation test.