Article Text

Original article
CagA mediates epigenetic regulation to attenuate let-7 expression in Helicobacter pylori-related carcinogenesis
  1. Yoshito Hayashi1,
  2. Masahiko Tsujii1,
  3. Jun Wang2,
  4. Jumpei Kondo1,
  5. Tomofumi Akasaka1,
  6. Ying Jin1,
  7. Wei Li1,
  8. Toru Nakamura3,
  9. Tsutomu Nishida1,
  10. Hideki Iijima1,
  11. Shingo Tsuji4,
  12. Sunao Kawano5,
  13. Norio Hayashi6,
  14. Tetsuo Takehara1
  1. 1Department of Gastroenterology and Hepatology, Osaka University Graduate School of Medicine, Suita, Osaka, Japan
  2. 2Department of Gastroenterology, No. 451 Hospital, Xi'an, China
  3. 3Department of Clinical Laboratory Science, Osaka University Graduate School of Medicine, Suita, Osaka, Japan
  4. 4Osaka Seamen's Hospital, Osaka, Osaka, Japan
  5. 5Health Care Center, Hankyu Hanshin Business Associate, Nishinomiya, Hyogo, Japan
  6. 6Kansai Rousai Hospital, Amagasaki, Hyogo, Japan
  1. Correspondence to Dr Tetsuo Takehara, Department of Gastroenterology and Hepatology, Osaka University Graduate School of Medicine, 2-2 Yamada-oka, Suita, Osaka 565-0871, Japan; takehara{at}gh.med.osaka-u.ac.jp

Abstract

Objective MicroRNAs (miRNAs) act as tumour suppressor genes or oncogenes in the regulation of multiple carcinogenic processes. Aberrant miRNA expression is reported in Helicobacter pylori (H pylori)-related gastritis and gastric cancer. The cytotoxin-associated gene A (CagA) of H pylori has a pathophysiologically important role in gastric carcinogenesis. A study was undertaken to evaluate the effect of CagA on miRNA expression and its regulatory mechanism.

Methods The effect of CagA on miRNA expression was assessed by comprehensive miRNA microarray. The mechanisms of the in vitro and in vivo effects of CagA on histone modification and DNA methylation and the involvement of CagA-dysregulated signal transduction on let-7, an important representative miRNA in gastric carcinogenesis, were investigated.

Results In in vitro experiments, CagA significantly attenuated let-7 expression leading to Ras pathway activation. CagA enhanced c-myc, DNA methyltransferase 3B (DNMT3B) and Enhancer of Zeste homologue 2 (EZH2) expression and attenuated miR-26a and miR-101 expression, which resulted in the attenuation of let-7 expression by histone and DNA methylation. Experiments performed in CagA transgenic mice revealed that c-myc, EZH2 and DNMT3B expression were enhanced and let-7 expression was attenuated to induce Ras oncoprotein expression in the stomach, with no associated inflammation.

Conclusions H pylori CagA induces aberrant epigenetic silencing of let-7 expression, leading to Ras upregulation.

  • Helicobacter Pylori
  • Gastric Cancer
  • Methylation

Statistics from Altmetric.com

Significance of this study

What is already known on this topic

  • Helicobacter pylori (H pylori) cytotoxin-associated gene A (CagA) is associated with gastric carcinogenesis.

  • H pylori alters microRNA expression in gastric epithelial cells.

  • H pylori infection mediates DNA methylation of some gene promoters through inflammation.

  • In CagA transgenic mice, CagA induces the development of malignant gastric tumours.

What this study adds

  • CagA epigenetically controls let-7 expression, leading to Ras upregulation.

  • CagA increases the expression of Myc, Polycomb gene EZH2 and DNA methyltransferase DNMT3B, leading to both histone and DNA methylation of the let-7 promoter.

  • Stomachs of CagA transgenic mice show higher expression of Myc, EZH2, DNMT3B and Ras protein and lower expression of let-7 compared with wild-type mice.

  • CagA involvement is implicated in gastric carcinogenesis without inflammation.

How might it impact clinical practice in the foreseeable future?

  • CagA-induced deregulation of epigenetics and microRNA expression is a novel potential target for the prevention and treatment of H pylori-related gastric carcinogenesis.

Introduction

Gastric cancer is the second most common cause of cancer-related mortality in the world.1 Infection with Helicobacter pylori (H pylori) is considered a high-risk factor for the development of gastric cancer.2 The clinical outcome of H pylori infection depends on the virulence of the bacterium, host genetic susceptibility and environmental factors.3 Current evidence suggests that two distinct molecular pathways are involved in gastric carcinogenesis induced by H pylori infection: direct action of the bacteria on gastric epithelial cells and indirect action resulting from prolonged bacterial infection and chronic inflammation.

H pylori strains possessing the cytotoxin-associated gene A (cagA) gene are more harmful to the gastric mucosa and are associated with an increased risk of atrophic gastritis, peptic ulcer and gastric cancer.4 ,5 Furthermore, cagA-positive H pylori strains are closely associated with gastric neoplasia,6 suggesting that CagA protein is directly involved in gastric carcinogenesis.7 In addition to the involvement of inflammation resulting from H pylori infection, CagA is considered to have carcinogenic potential. CagA protein injected from H pylori into host gastric epithelial cells via a bacterial type IV secretion system8 disrupts signal transduction.9

MicroRNAs (miRNAs) have various important roles in the expression of genes involved in cell differentiation, proliferation and apoptosis.10 ,11 Regulation of miRNA is a complicated process and some components involved in regulation are altered in human cancers.12 Although H pylori infection13 and gastric carcinogenesis14 are associated with the altered expression of several miRNAs, direct effects of CagA on miRNA expression have not yet been reported.

Epigenetic alterations, represented by aberrant DNA methylation or histone modification, are deeply involved in human cancers as a distinct and crucial mechanism to silence a variety of methylated tissue-specific and imprinted genes.15 miRNA expression is also affected by aberrant epigenetic alterations.16 In H pylori-infected gastric mucosa and gastric cancer, aberrant DNA methylation is detected,17 and increased DNA methylation induces H pylori-related inflammation.18 The effect of CagA per se on epigenetic modulation, however, has not yet been demonstrated. In the present study we first investigated the effect of CagA on miRNA expression in gastric epithelial cells. Among several miRNAs affected by CagA expression, we evaluated let-7 because of its pivotal role in carcinogenesis. Moreover, to clarify the mechanism underlying the effect of CagA on let-7 attenuation, we investigated how CagA affects histone and DNA methylation of the let-7 promoter region.

Materials and methods

Preparation of CagA-expressing cells

Rat gastric mucosal cells (RGM1) were maintained as previously described.19 For miRNA array analysis we designated a cell clone transfected to express the cagA gene (ABCCC; Western type) under the tet-off system, as described previously.19 The microarray methods and data are available from National Center for Biotechnology Information (USA) Gene Expression Omnibus, accession number GSE27009.

For in vitro experiments of signal transduction we used RGM1 cells transiently transfected with CagA (ABCCC type) expression vector plasmids (gift from Dr Higashi, Hokkaido University, Sapporo, Japan) as RGM1-CagA cells or with control empty vector plasmids as RGM1-mock cells. ABCCC-type and ABD-type (East Asian type) cagA genes were isolated from H pylori strains NCTC11637 and F32, respectively. All plasmids were transfected with Lipofectamine 2000 (Invitrogen, Carlsbad, California, USA).

Mice

The bacterial Western type cagA-ABCCC gene derived from the H pylori NCTC11637 strain was subcloned into a mammalian expression vector with a cytomegalovirus promoter. The CMV-cagA-ABCCC fragment was excised by restriction enzyme digestion and injected directly into the fertilised eggs of C57BL/6J mice. Homozygous cagA-ABCCC-expressing mice were prepared by crossing heterozygous cagA-ABCCC-expressing mice. All of the animal experiments were performed according to the protocol approved by the Animal Care and Use Committee of Osaka University Medical School.

Methylation analysis

After DNA extraction using a Gentra Puregene Cell Kit (Qiagen, Hilden, Germany), methylation analysis was performed using methylation-sensitive restriction enzyme Hpa II and a methylation-non-sensitive restriction enzyme Msp I (New England BioLabs, Ipswitch, Connecticut, USA). After incubation at 37°C for 24 h, PCR amplification was performed under the following conditions: initial denaturation step at 95°C for 5 min, then 40 cycles of the following: 95°C for 30 s, 58°C for 30 s, and 72°C for 15 s; and an extension step at 72°C for 5 min. The following primer pairs were used: sense, 5′-CTCTGCTTAGGAAGGCTGTG and antisense, 5′-AGAGGACTGGGTTTCTCTCG. Quantification of band intensity was performed using Image J software (National Institutes of Health, USA). For the 5-aza-2′-deoxycytidine (5-AZA) experiment, cells were treated with 10 μM 5-AZA for 72 h prior to RNA and protein isolation.

Chromatin immunoprecipitation assay

A chromatin immunoprecipitation (ChIP) assay was performed using a Magnify Chromatin Immunop kit (Invitrogen) following the manufacturer's protocol. RGM1 cells (1×107 cells) in a 10 cm dish were transfected with mock or CagA expression vector for 4 h. The protein was crosslinked to the DNA with formaldehyde (1% final concentration) and the cells were lysed. Lysates were sonicated 20 times with a 10 s pulse at 50 s intervals. Sheared chromatin was immunoprecipitated with trimethylation of lysine 27 on histone H3 (H3K27me3) and Enhancer of Zeste homologue 2 (EZH2) antibodies (see online supplementary table S1) overnight at 4°C. Two primers were designed based on the let-7c promoter which was previously analysed in a methylation restriction enzyme study. The two primers were as follows: sense, AGCCTTCTGAGCCAGTTTCTTC and antisense, CCCGAGCAGTAGCAGTGTG (primer 1); and sense, CGGGTGCTTTCTATCTCTTCTCC and antisense, TGGATGCCGTGGCTTCTCG (primer 2). Quantitative PCR was performed with QuantiFast SYBR Green PCR (Qiagen) kit on a Light Cycler (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's protocol.

Ras activation assay

The assay was performed using Active Ras Pull-Down and Detection Kits (Thermo Fisher Scientific, Waltham, Massachusetts, USA) according to the manufacturer's instructions. The Ras-GTP level was determined by western blot analysis.

Western blot analysis

Western blot analysis was performed as previously described.20 A detailed description of the antibodies used is provided in online supplementary table S1. Expression of beta-actin was analysed as a control.

Reverse transcription (RT)-PCR analysis

Total RNA was extracted from RGM1 cells or mouse stomach tissue using the mirVana miRNA isolation kit (Applied Biosystems, Foster City, California, USA). RNA was reverse-transcribed using a High Capacity Reverse Transcription Kit or TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems) according to the manufacturer's protocol. The PCR reaction was performed as previously described.20 MicroRNA expression of the specific genes was quantified using a TaqMan MicroRNA Expression Assay (Applied Biosystems). MicroRNA expression levels were standardised by comparison with U87 for rat cells, sno-RNA-202 for mouse cells and RNU48 for human cells. The CDX2 expression level was standardised by comparison with beta-actin. The primer sets used are listed in online supplementary table S2. Transcript levels are presented as fold induction.

Immunoprecipitation assay

Cells were lysed with TNE buffer containing protease inhibitor and phosphatase inhibitor 6 h after mock or CagA expression vector transfection. An immunoprecipitation assay was performed using an Immunoprecipitation Kit (Invitrogen). Antibodies were mixed with lysate overnight at 4°C and the immunocomplex was analysed by western blot analysis. A detailed description of the antibodies used is provided in online supplementary table S1.

Small interfering RNA (siRNA)-mediated knockdown

Cultured RGM1 cells in six-well plates were treated with siRNA against c-myc (Oligo ID; RSS351380) and ezh2 (Oligo ID; RSS358579) (Invitrogen) using Lipofectamine RNA-iMAX (Invitrogen) according to the manufacturer's protocol. Stealth RNAi negative control (Invitrogen) was used as the control.

miRNA precursor treatment

Cultured RGM1 cells in six-well plates were treated with miRNA precursor (Applied Biosystems) against let-7a (Product ID; PM10050), let-7c (Product ID; PM10436), miR-26a (Product ID; PM10249) and miR-101 (Product ID; PM11414) according to the manufacturer's protocol. Pre-miR Negative Control (Applied Biosystems) was used as the control.

Immunohistochemistry

Stomach tissue sections from mice aged 18 weeks were subjected to immunostaining for Ki67 and CDX2 and counterstained with haematoxylin. Immunostaining was performed as described previously.20 ,21 The Ki67-positive cells in each gland of the antrum were counted. A detailed description of the antibody used is provided in online supplementary table S1.

Statistical analysis

All data are expressed as mean±SD. Statistical analyses were performed using the unpaired Student t test. A p value of <0.05 was considered statistically significant. A more detailed description of the materials used is given in the online supplement.

Results

CagA suppresses let-7 expression and upregulates Ras expression

MicroRNAs whose expression was affected by CagA were screened using a clone of non-transformed gastric epithelial cells expressing CagA under the tet-off system.19 The miRNA array comprehensive assay revealed that CagA downregulated the expression of several miRNAs (table 1). Among these miRNAs, we focused on the let-7 family because of its pivotal role in carcinogenesis. In fact, its expression is suppressed in H pylori-associated gastritis or gastric cancer.22 ,23 To date, there have been no reports on either the precise mechanism of H pylori to reduce let-7 expression or a direct relationship between CagA and the let-7 family. We therefore investigated the mechanism underlying CagA-induced suppression of let-7 expression.

Table 1

CagA-expressing gastric epithelial cells contained less than 60% downregulated miRNAs compared with CagA-non-expressing cells

For the following studies, we used transiently CagA-transfected RGM1 cells to eliminate the possibility of evaluating the results of studies of a single clone. We first confirmed CagA expression by western blot analysis (figure 1A). Expression of both let-7a and let-7c was significantly attenuated by CagA (figure 1B).

Figure 1

CagA suppresses let-7a and let-7c expression, which leads to Ras upregulation. (A) Expression of CagA in RGM1 cells after transient transfection with mock or CagA expression vector was assessed by western blot analysis. (B) Expression of let-7a (left panel) and let-7c (right panel) in RGM1 cells after mock or CagA expression vector transfection was determined by quantitative RT-PCR (n=4/group); *p<0.05 vs control group. (C) Expression of Ras protein in RGM1-mock or -CagA cells was assessed by western blot analysis. The cells were harvested 48 h after mock or CagA expression vector transfection. (D) Expression of activated Ras was assessed using a Ras-GTP pull-down assay. Phosphorylated extracellular signal-regulated kinase was assessed by western blot analysis. Protein was extracted 48 h after mock or CagA expression vector transfection. (E) Expression of Ras protein was assessed by western blot analysis to test the effect on let-7 forced expression in RGM1-CagA cells. RGM1 cells were treated with let-7a (left panel) or let-7c (right panel) precursor and negative control precursor (control). Non-treated sample is shown as the positive control. The cells were harvested 12 h after CagA expression vector transfection.

MicroRNA let-7 family members function as tumour-suppressor genes by negatively regulating Ras levels.24 In the present study, we found that Ras protein expression was stimulated in CagA-expressing RGM1 cells (figure 1C). To elucidate whether this Ras expression really linked to Ras activation, we performed a Ras-GTP pull-down assay. We detected activated Ras and extracellular signal-regulated kinase (ERK) phosphorylation in CagA-expressing RGM1 cells (figure 1D). Restoration of let-7a or let-7c by precursor transfection decreased the CagA-induced increase in Ras protein expression, suggesting that CagA suppressed let-7 expression in gastric epithelial cells, leading to enhanced Ras expression (figure 1E).

CagA enhances EZH2 expression, leading to increased H3K27 trimethylation and DNA methylation in the let-7 promoter

MicroRNA expression is affected by epigenetics,25 and histone and DNA methylation are cooperatively involved in epigenetic regulatory mechanisms.26 EZH2, a histone methyltransferase that trimethylates H3K27, interacts with DNA methyltransferases (DNMTs), thus implicating its involvement in gene silencing via histone and DNA methylation.26–28 To explore the underlying mechanism of let-7 dysregulation by CagA, we first investigated the effect of CagA on histone methylation of the let-7 promoter. CagA clearly acted to increase EZH2 expression in RGM1 cells (figure 2A).

Figure 2

EZH2 is involved in CagA-induced aberrant histone hypermethylation of the let-7 promoter. (A) Expression of EZH2 expression in RGM1-mock or -CagA cells was determined by western blot analysis. The cells were harvested 6 h after mock or CagA expression vector transfection. (B) Chromatin immunoprecipitation (ChIP) assay using antibodies of EZH2 and H3K27me3 for the let-7c promoter. The product size of both was 177 base pairs. (C) Quantitative ChIP assay of EZH2 and H3K27me3. Two different primers were used: primer 1 (left panel) and primer 2 (right panel) (n=4/group); *p<0.05 vs control group. (D) Expression of EZH2 protein in RGM1-mock or -CagA cells after treatment with EZH2 siRNA or control siRNA was assessed by western blot analysis (left panel). Expression of let-7c after treatment with EZH2 siRNA or control siRNA was determined by quantitative RT-PCR (right panel) (n=4/group); *p<0.05 vs control group. (E) The effect of EZH2 on CagA-induced Ras expression was investigated by western blot analysis. Expression of Ras protein after treatment with EZH2 siRNA or control siRNA in RGM1-mock or -CagA cells was assessed by western blot analysis. The cells were harvested 48 h after mock or CagA expression vector transfection.

To assess the effect of upregulated EZH2 on the let-7c promoter, a ChIP assay was performed. Two different primers were constructed for a specific let-7c promoter. The ChIP results demonstrated that EZH2 was directly associated with the let-7c promoter (figure 2B). Quantitative ChIP results using anti-EZH2 antibody showed that CagA significantly enhanced EZH2 binding to the let-7c promoter with both primers (figure 2C). Moreover, quantitative ChIP analysis using an anti-H3K27me3 antibody showed that CagA significantly enhanced H3K27 trimethylation (ie, EZH2-specific chromatin repressive marks) in the let-7c promoter region (figure 2C). These findings suggest that CagA-upregulated EZH2 functions as a subunit of Polycomb repressive complex 2 (PRC2), leading to trimethylation of H3K27 in the let-7c promoter.

To identify the role of EZH2 in let-7c epigenetic suppression, we performed siRNA-mediated knockdown of EZH2. Deletion of EZH2 restored let-7c expression in CagA-expressing RGM1 cells (figure 2D). To elucidate whether EZH2 expression involves Ras expression through let-7 attenuation, we investigated Ras expression under siRNA-mediated EZH2 deletion. Western blot analysis revealed that EZH2 knockdown prevented Ras enhancement by CagA expression (figure 2E). These findings indicate that EZH2 is involved in CagA-induced let-7 suppression.

Myc regulates EZH2 expression through the attenuation of miR-26a and miR-101

To assess the mechanism of the CagA-induced upregulation of EZH2 expression, we investigated the involvement of Myc in EZH2 expression in CagA-expressing cells because Myc is a key molecule involved in regulating EZH2 expression.29 Previous studies suggested that H pylori affects c-myc expression.30–32 Consistent with these reports, CagA clearly enhanced c-myc expression in RGM1 cells (figure 3A).

Figure 3

CagA-enhanced c-myc expression facilitates EZH2 upregulation and resultant let-7c attenuation via miR-26a and miR-101 reduction. (A) Expression of c-myc protein in RGM1-mock or -CagA cells was assessed by western blot analysis. The cells were harvested 6 h after mock or CagA expression vector transfection. (B) Effect of c-myc on CagA-induced EZH2 expression was investigated by western blot analysis. Expression of c-myc and EZH2 protein after treatment with c-myc siRNA or control siRNA in RGM1-mock or -CagA cells was assessed by western blot analysis. The cells were harvested 6 h after mock or CagA expression vector transfection. (C) Expression of miR-26a and miR-101 in RGM1-mock or -CagA cells was determined by quantitative RT-PCR (n=4/group); *p<0.05 vs control group. (D) Expression of EZH2 and Ras protein was assessed by western blot analysis to test the effects of miR-26a and miR-101 restoration. RGM1 cells were treated with miR-26a or miR-101 precursor and negative control precursor (control). A non-treated sample is shown as the positive control. The cells were harvested 12 h after CagA expression vector transfection. (E) Expression of miR-26a (left panel) and miR-101 (right panel) in RGM1-mock or -CagA cells after treatment with either control siRNA (si-control) or c-myc siRNA was determined by quantitative RT-PCR (n=5/group); *p<0.05 vs control group. (F) Expression of let-7a (left panel) and let-7c (right panel) in RGM1-mock or -CagA cells after treatment with either control siRNA (si-control) or c-myc siRNA was determined by quantitative RT-PCR (n=5/group); *p<0.05 vs control group.

To clarify the causal relationship between c-myc and EZH2, we performed c-myc knockdown experiments and found that c-myc deletion suppressed CagA-enhanced EZH2 expression (figure 3B). The comprehensive miRNA array showed that CagA attenuated both miR-26a and miR-101, which are known negative regulators of EZH2 expression (table 1).29 ,33 In the transient CagA expression study, we confirmed that CagA significantly suppressed both miR-26a and miR-101 expression (figure 3C). Restoration of the expression of miR-26a and miR-101 with their precursors decreased EZH2 and Ras expression in CagA-expressing cells (figure 3D). Deletion of c-myc expression by siRNA inhibited miR-26a and miR-101 attenuation in CagA-expressing cells (figure 3E). These findings indicate that CagA-enhanced Myc decreased both miR-26a and miR-101, leading to increased EZH2 expression.

In addition, we investigated the role of c-myc in the regulation of let-7 expression in CagA-expressing cells. To assess the relationship between c-myc and let-7, we performed c-myc knockdown experiments. CagA attenuated let-7a and let-7c expression, but deletion of c-myc expression by siRNA inhibited the suppression of both let-7a and let-7c miRNAs in RGM1-CagA cells (figure 3F). These findings demonstrate the important role of CagA-upregulated c-myc expression in let-7a and let-7c downregulation.

Aberrant DNA methylation is involved in let-7 expression dysregulated by CagA

Previous reports suggest that let-7 expression is silenced by DNA methylation of the promoter.34 In the next step, we investigated the effect of CagA on DNA methylation of the let-7 promoter.

First, we investigated the effect of the DNMT inhibitor 5-AZA on let-7c and Ras expression in CagA-expressing RGM1 cells. In the presence of 5-AZA, CagA did not influence let-7c or Ras expression (figure 4A,B) while, in the absence of 5-AZA, CagA decreased let-7 expression and increased Ras expression in RGM1 cells (figure 1B), indicating that DNA methylation was involved in the downregulation of let-7c expression by CagA.

Figure 4

CagA induces aberrant DNA hypermethylation of the let-7 promoter. (A) Expression of let-7c expression was determined by quantitative RT-PCR in RGM1-mock or -CagA cells in the presence of 5-aza-2′-deoxycytidine (5-AZA; n=4/group); *p<0.05 vs control group. Error bars indicate SD. (B) Expression of Ras protein in the absence or presence of 5-AZA was assessed by western blot analysis. The cells were harvested 48 h after mock or CagA expression vector transfection. (C) Time-course of methylation status in the let-7c promoter after mock or CagA expression vector transfection was investigated by PCR using methyl-specific restriction enzyme (left panel). The cells were harvested at the indicated hours after transfection. ‘Control’ indicates PCR products without restriction enzyme. The ratios of the band intensity of Hpa II relative to control 6 h after mock or CagA expression vector transfection were quantitatively analysed (right panel) (n=3/group); *p<0.05 vs control group.

We next estimated the DNA methylation status of CpG islands at the 5′ end of rat let-7c by restriction enzyme PCR, as described previously.35 This method for distinguishing methylated from unmethylated alleles is based on cutting by a methylation-sensitive restriction enzyme (Hpa II) and subsequently amplifying the gene fragment by PCR (amplifying without a restriction enzyme is the positive control and amplifying with a methylation-non-sensitive restriction enzyme (Msp I) is the negative control). We constructed primers with which we could obtain 776 base pairs containing four Hpa II/Msp I digestive sites (CCGG bases). Using this method, we detected Hpa II-undigested PCR products when CpGs of the let-7c promoter were methylated. Undigested PCR products significantly increased after CagA induction compared with mock plasmid-transfected cells (figure 4C). These findings suggest that CagA expression induced DNA hypermethylation in the let-7c promoter region.

Next, we investigated the effect of CagA on the expression on DNMTs that have an important role in DNA methylation and found that CagA enhanced DNMT3B expression in RGM1 cells (figure 5A). DNMT3B is a de novo methyltransferase that is crucial for early development during carcinogenesis.36 DNMT3B recruitment to the target gene promoter is facilitated through interactions with EZH2 and c-Myc.28 Our immunoprecipitation assay revealed that c-myc, EZH2, and DNMT3B were bound to each other (figure 5B). Furthermore, deletion of EZH2 expression by siRNA suppressed DNA hypermethylation in CagA-expressing cells (figure 5C), suggesting that histone methyltransferase was cooperatively involved in DNA methylation.

Figure 5

CagA induces histone methylation of the let-7 promoter through the formation of a c-myc/EZH2/DNMT3B complex. (A) Expression of DNMT3B in RGM1-mock or -CagA cells was assessed by western blot analysis. The cells were harvested 6 h after mock or CagA expression vector transfection. (B) Immunoprecipitation of DNMT3B, EZH2 and c-myc in RGM-mock or -CagA cells. Protein was extracted 6 h after mock or CagA expression vector transfection. Expression of DNMT3B and EZH2 protein was assessed by western blot analysis. (C) Effect of CagA-upregulated EZH2 on methylation status of the let-7c promoter. Methylation analysis of let-7 promoter under treatment with EZH2 knockdown was performed. ‘Control’ indicates PCR products without restriction enzyme. DNA was extracted 6 h after mock or CagA expression vector transfection.

East Asian type CagA elicits the same effect as Western type CagA in RGM1 cells.

As shown above, we demonstrated that ABCCC type CagA protein induced c-myc, EZH2 and DNMT3B expression and attenuated let-7 expression, which led to Ras activation. The prevalent forms of the CagA species are the A-B-C type (Western type) and the A-B-D type (East Asian type) at the C-terminal EPIYA motifs. We investigated the oncogenic potentials of ABD CagA by transfection of ABD-cagA expression vector to RGM1 cells. Myc, EZH2 and DNMT3B expression were increased by ABD CagA expression, and both let-7a and let-7c were attenuated (see online supplementary figure S1A,B). Ras expression was upregulated by ABD CagA expression (see online supplementary figure S1C). Furthermore, we confirmed that phosphorylated ERK was induced (see online supplementary figure S1D). These results indicated that both ABCCC and ABD type CagA have similar oncogenic potential at the point of let-7 silencing.

cagA-positive H pylori infection attenuates let-7 expression

To elucidate the significance of CagA in H pylori infection, we performed an infection assay using cagA-positive (NCTC11637) and cagA-deficient H pylori. Generally, the establishment of H pylori infection in cultured cells is confirmed by the detection of CagA tyrosine phosphorylation. Because we confirmed that RGM1 cells were not infected with H pylori, we used the AGS gastric cancer cell line (see online supplementary figure S2A). In AGS cells, cagA-positive H pylori infection elicited c-myc, EZH2, DNMT3B and Ras expression (see online supplementary figure S2B,D,F). After infection of cagA-positive H pylori, let-7a, let-7c and miR-26a were significantly attenuated compared with cagA-deficient H pylori (see online supplementary figure S2C,E). These results were consistent with the results derived from the study of CagA expression vector transfection to RGM1 cells and CagA transgenic mice.

Dysregulation of let-7 impacts CagA transgenic mice

Finally, to explore these roles of CagA in vivo, we generated cagA homozygous transgenic mice. CagA transgenic mice develop significantly more gastric tumours compared with wild-type (WT) mice.37 Expression of the CagA protein in the stomach was confirmed in the CagA transgenic mice (figure 6A). Neutrophil or lymphoid cell infiltration was not detected in gastric mucosa of CagA transgenic mice. Consistent with the results of the in vitro study, the expression of both let-7a and let-7c in the stomach was attenuated in the CagA transgenic mice compared with that in WT mice at 12 weeks of age (figure 6B). In addition, expression of Ras, c-myc, EZH2 and DNMT3B was also upregulated in CagA transgenic mice (figure 6C). A Ras-GTP pull-down assay revealed that Ras upregulation was linked to Ras activation and ERK phosphorylation (figure 6D). These findings support the notion that CagA increased c-myc, EZH2 and DNMT3B expression and attenuated let-7 expression in vivo, as demonstrated in in vitro experiments. To investigate the effect of CagA on epithelial cell proliferation in the mouse stomach, we performed Ki67 immunohistochemistry of the gastric mucosa. Ki67-positive cells were significantly increased in CagA transgenic mice compared with WT mice at 18 weeks of age (figure 6E,F). To clarify whether CagA expression is related to intestinal metaplasia, we investigated the expression of a representative metaplasia marker, CDX2. The results of quantitative RT-PCR demonstrated no relevant involvement of CDX2 expression by CagA (see online supplementary figure S3A). Metaplastic change was not detected by CDX2 immunohistochemistry or alcian blue/high iron diamine staining in the stomach of CagA transgenic mice or WT mice (see online supplementary figure S3B).

Figure 6

CagA transgenic mice show aberrant expression of let-7 miRNA and c-myc, DNMT3B, EZH2 and Ras protein. (A) Expression of CagA in the stomach of wild-type mice (WT) and CagA transgenic mice (CagA Tg) at 12 weeks of age was assessed by western blot analysis. (B) Expression of let-7a (left panel) and let-7c (right panel) in the stomachs of CagA Tg compared with WT at 12 weeks of age was determined by quantitative RT-PCR (n=5/group); *p<0.05 vs control group. (C) Expression of Ras, c-myc, EZH2 and DNMT3B in the stomach of CagA Tg compared with WT mice at 12 weeks of age was assessed by western blot analysis. (D) Expression of activated Ras in the stomach of WT and CagA Tg mice at 12 weeks of age was assessed using a Ras-GTP pull-down assay. Phosphorylated extracellular signal-regulated kinase (pERK) was assessed by western blot analysis. (E) Ki67 expression in the stomach section was determined by immunohistochemical analysis. (F) Ki67-positive cells per gland in the stomach section were counted in WT and CagA Tg mice at 18 weeks of age (n=5/group); *p<0.05 vs control group.

Discussion

Accumulating evidence reveals that the expression of miRNAs, post-transcriptional regulators of gene expression, is frequently altered in various cancers and plays an important role in carcinogenesis.10 MicroRNAs function as either oncogenes or tumour suppressors by regulating downstream genes that are activated in tumour initiation or progression and are considered to play a variety of crucial roles in gastric carcinogenesis. H pylori infection, on the other hand, causes the development of gastric cancer. CagA-positive H pylori strains are particularly harmful to human gastric mucosa because of their oncogenic potential. In the present study, we aimed to explore the effect of CagA on miRNA expression and its regulatory mechanism using the RGM1 cell line,38 non-transformed gastric mucosal cells, because H pylori infection is usually acquired in non-cancerous gastric epithelial cells. Generally, the expression levels of miRNAs, oncogenes and tumour suppressor genes differ between transformed cells and non-transformed cells.39 The comprehensive miRNA array assay revealed that, along with CagA expression, the expression levels of several miRNAs were altered in gastric epithelial cells. Some of them—for example, miR-145 expression,40 miR-195 and miR-497 expression41 and miR-212 expression42—are related to gastric carcinogenesis. Among them, the expression level of let-7 miRNA, a well-known regulator of oncogenic genes, is attenuated in H pylori-induced gastritis.23 In addition, its expression is significantly lower in gastric tumour tissues than in normal epithelium.22 We therefore focused on the effect of CagA on let-7 expression and found that CagA attenuated let-7 expression, followed by an upregulation of Ras expression in gastric epithelial cells, suggesting that let-7 plays a crucial role in CagA-related gastric carcinogenesis.

The present study revealed that epigenetics are involved in the CagA suppression of let-7. Many miRNA genes are located in CpG islands, and their expression is altered by epigenetics: histone and DNA methylation.25 ,43 Both our in vitro and in vivo results showed that CagA enhanced the expression of EZH2 and DNMT3B, which are histone- and DNA-methyltransferases, respectively. In gastric cancers, tumour suppressor genes are inactivated more frequently by promoter methylation than by mutations.44 Therefore, the main molecular mechanism implicated in gastric cancer-related molecular alterations is of an epigenetic nature. H pylori infection, a major risk factor for gastric cancer, induces the methylation of specific genes in the gastric mucosa. Several findings support the idea that the infection-associated inflammatory response is responsible for inducing altered DNA methylation.17 It is possible, however, that CagA itself induces epigenetic dysregulation because CagA plays an important role in carcinogenesis via dysregulated pivotal signal transductions, and CagA transgenic mice develop gastric adenocarcinoma without overt inflammation.37 In the present study the in vitro and in vivo results indicated that CagA induced epigenetic changes, consequently affecting miRNA expression and upregulating Ras expression without inflammation.

Our results indicate that c-myc expression dysregulated by CagA is involved in inducing epigenetic alterations. Several reports indicate that CagA upregulates c-myc expression.31 ,32 ,45 Indeed, Myc represses let-7 expression by binding to the promoter.46 Moreover, the present study showed new findings that Myc has two crucial roles in let-7 suppression: (1) induction of EZH2 expression and (2) complex formation with EZH2 and DNMT3B, to enhance an EZH2-mediated histone methylation and functionally linked DNA methylation of the let-7 promoter.

We propose a novel mechanism underlying the direct involvement of CagA in the carcinogenic pathway: CagA is functionally relevant to EZH2 induction via c-myc upregulation. EZH2 plays a master regulatory role in controlling important cellular processes such as stem cell maintenance, cell proliferation and embryogenesis in multi-protein complex PRC2. EZH2 is broadly overexpressed in aggressive solid tumours and has oncogenic properties as its overexpression promotes cell proliferation, colony formation and invasion. EZH2 overexpression contributes to the progression and oncogenesis of gastric cancers.47 The primary activity of the EZH2 complex is to trimethylate H3K27 at the target gene product, leading to epigenetic silencing via the recruitment of DNMTs.27 In this study we found that EZH2 induced by CagA enhanced H3K27 trimethylation and DNA methylation in the let-7c promoter. EZH2 expression is controlled by miR-26a and miR-101. MYC stimulates EZH2 expression by repressing miR-26a in lymphomagenesis.29 miR-101 acts as an important tumour suppressor in various cancers, targeting two essential components of the PRC2 complex (EZH2 and EED),48 and is downregulated in gastric cancer.49 Notably, our comprehensive microarray data demonstrated that CagA per se attenuated the expression of let-7 and also miR-26a and miR-101. We also showed that CagA-upregulated Myc reduced both miR-26a and miR-101 expression, leading to enhanced EZH2 expression.

In the stomachs of CagA transgenic mice, expression of c-myc, EZH2, DNMT3B and Ras was increased while let-7 expression was suppressed. Furthermore, Ras activity and ERK phosphorylation were significantly enhanced. The number of Ki67-positive cells was significantly increased in CagA transgenic mice compared with WT mice, suggesting that CagA expression led to gastric epithelial cell progression. Hatakeyama et al reported that CagA transgenic mice develop gastrointestinal neoplasms in long-term feeding.37 Our results suggest that CagA affects let-7 dysregulation by c-myc, EZH2 and DNMT3B induction, cooperatively leading to gastric carcinogenesis, and indicate the importance of CagA function as an oncogenic protein in the absence of mucosal inflammation or metaplastic change.

We have demonstrated that CagA affects miRNA expression in gastric epithelial cells. Furthermore, by focusing on let-7 expression among the miRNAs downregulated by CagA, we have shown that CagA-upregulated c-myc enhances the expression of the Polycomb gene EZH2 via miR-101 and miR-26a downregulation leading to accelerated histone and DNA methylation in the let-7 promoter, thereby suppressing its own expression. These results shed light on a novel CagA function in the oncogenic pathway via dysregulated expression of the epigenetic-related genes EZH2 and DNMT and resultant aberrant miRNA expression. These mechanisms will be useful in the elucidation of H pylori-related carcinogenesis.

Acknowledgments

The authors thank Dr Masanori Hatakeyama (Tokyo University), Dr Naoko Murata-Kamiya (Tokyo University) and Dr Hideaki Higashi (Hokkaido University) for providing materials.

References

Supplementary materials

  • Supplementary Data

    This web only file has been produced by the BMJ Publishing Group from an electronic file supplied by the author(s) and has not been edited for content.

    Files in this Data Supplement:

Footnotes

  • YH and MT contributed equally

  • Correction notice This article has been corrected since it was published Online First. The author names Yin Jing and Wang Jun have been amended to read Ying Jin and Jun Wang.

  • Contributors YH designed and performed the experiments, analysed the data and wrote the manuscript. MT planned and designed the experiments, interpreted the results and wrote the manuscript. WJ and WL helped with experimental procedures. TN performed microRNA array procedures. JK, TA, YJ, TN, ST and HI provided feedback and experimental advice. SK, NH and TT supervised the project and edited the manuscript.

  • Funding This work was supported in part by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Sciences, and Technology, Japan (to MT).

  • Competing interests None.

  • Ethics approval Approval for this study was granted by the Committee for Animal Experimentation of Osaka University.

  • Provenance and peer review Not commissioned; externally peer reviewed.

  • Data sharing statement The microarray data have been deposited with Gene Expression Omnibus of US National Center for Biotechnology Information (USA) under accession number GSE27009.

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.