Article Text

PDF

Letter
TREM-1, the ideal predictive biomarker for endoscopic healing in anti-TNF-treated Crohn’s disease patients?
  1. Bram Verstockt1,2,
  2. Sare Verstockt3,
  3. Helene Blevi2,
  4. Isabelle Cleynen3,
  5. Magali de Bruyn2,
  6. Gert Van Assche1,2,
  7. Séverine Vermeire1,2,
  8. Marc Ferrante1,2
  1. 1 Department of Gastroenterology and Hepatology, University Hospitals Leuven, KU Leuven, Leuven, Belgium
  2. 2 Department of Chronic Diseases, Metabolism and Ageing, Translational Research Centre for Gastrointestinal Disorders (TARGID-IBD), KU Leuven, Leuven, Belgium
  3. 3 Laboratory for Complex Genetics, Department of Human Genetics, KU Leuven, Leuven, Belgium
  1. Correspondence to Prof Marc Ferrante, Department of Gastroenterology and Hepatology, UZ Leuven, Leuven, B3000, Belgium; marc.ferrante{at}uzleuven.be

Statistics from Altmetric.com

We read with great interest the study by Gaujoux et al, who described a whole blood marker for anti-tumour necrosis factor (TNF) responsiveness in patients with Crohn’s disease (CD). The availability of anti-TNF agents dramatically changed therapeutic strategies for patients with CD. However, an overall non-response rate of 30% has been observed, and, together with the approval of new classes of biological agents with a different mode of action, clearly indicates the need for predictive biomarkers. Gaujoux et al identified triggering receptor expressed on myeloid cells 1 (TREM1) expression in whole blood as a biomarker for anti-TNF (non)response (higher expression in responders).1 In inflamed colonic tissue, TREM1 expression is also decreased in future infliximab responders.1 2 TREM-1 is known to amplify inflammation, whereas TREM-1 inhibition in vivo attenuates colitis by modulating autophagy and endoplasmic reticulum (ER) stress.3

We first measured serum TREM-1 (sTREM-1) (Human sTREM-1 ELISA (HK348), Hycult Biotech, Uden, the Netherlands) in 85 patients with CD with active disease prior to anti-TNF therapy (table 1). To reduce the risk of including treatment failures secondary to immunogenicity (and not drug mechanistic failure) or non-drug-related healers, all included patients had to have a good drug exposure, defined as a maintenance trough level >3.0 µg/mL for infliximab or >5.0 µg/mL for adalimumab. Interestingly, patients who achieved mucosal healing (complete absence of ulcerations and erosions4) after 6 months of anti-TNF therapy (adalimumab and infliximab) had significantly lower baseline sTREM-1 levels compared with non-responders (50.8 pg/mL vs 106.4 pg/mL, p=0.001). Patients who did experience some endoscopic benefit without achieving full healing had sTREM-1 levels in between remitters and non-responders (figure 1A). Receiver operating characteristic (ROC) analysis showed a limited area under the curve (AUC, 95% CI) of 0.68 (0.56 to 0.80) for sTREM-1 as a predictive biomarker (p=0.009).

Figure 1

(A) Baseline serum TREM-1 in relation to endoscopic outcome after 6 months anti-TNF therapy. Levels below the limit of detection were replaced by the lower limit of detection (31.0 pg/mL). (B) Baseline TREM1 mRNA expression (measured through qRT-PCR) in whole blood in relation to endoscopic outcome after 6 months anti-TNF therapy. The TREM1 expression levels are normalised to beta actin. TNF, tumour necrosis factor; TREM-1, triggering receptor expressed on myeloid cells 1.

We next studied whole blood TREM1 expression in a second prospectively collected, consecutive cohort of 20 patients with CD with active endoscopic disease, prior to anti-TNF therapy (table 1) through quantitative real-time reverse-transcriptase PCR (qRT-PCR). Similar inclusion criteria in terms of drug exposure were applied. The TREM1 forward ATGATCATGGTTTACTGCGCG and reverse CATGTGAGGCTCCTTGGGAG primers were synthesised by Sigma-Genosys (Haverhill, UK).5 All samples were amplified in duplicate reactions. β-actin was used as an endogenous reference gene. In contrast to the findings by Gaujoux et al, we observed a significant downregulation of TREM1 at baseline in patients with CD who achieved mucosal healing after 6 months of anti-TNF therapy (p=0.02; AUC 0.80 (0.60 to 1.00)) (figure 1B).

Table 1

Disease characteristics included of patients with CD

The reason for the discrepancy between our findings and the results reported by Gaujoux and colleagues could potentially be attributed to sample size, as both cohorts are rather small. Additionally, we applied a different and more stringent definition of response, defined endoscopically, in this treat-to-target era. Furthermore, both cohorts may represent patients with a different ethnicity.

Nevertheless, the low sTREM-1 levels in healers would functionally corroborate high membrane TREM-1 expression, or TREM-1 function in the peripheral blood, as sTREM-1 is believed to function as a decoy receptor. However, recently, the origin of sTREM-1 has been established in mice, demonstrating that membrane TREM-1 contains a matrix metalloproteinase 9 (MMP-9) cleavage site and that the inhibition of MMP-9 reduces the amount of sTREM-1.6 Similarly, human TREM-1 also contains a theoretical MMP-9 cleavage site,7 raising the hypothesis that sTREM-1 is cleaved off the cell surface by MMPs.8 Because the mRNA transcript measured in this study represents the entire TREM1 gene and sTREM-1 is a protein derived from mTREM-1,8 we cannot differentiate between mTREM-1 and sTREM-1 on the mRNA level. Our data, however, are not contradictory to the current belief of an inverse correlation between sTREM-1 and mTREM-1: as the overall TREM1 expression is increased in non-healers, the sTREM-1 level will increase too due to cleavage. We do however agree that further research is needed to differentiate between the different transcripts of TREM1,9 and how this relates to the prediction of anti-TNF responsiveness.

In conclusion, TREM-1 seems important in the (non-)responsiveness to anti-TNF therapy in patients with CD and could potentially serve as a predictive biomarker. In contrast to the recent findings by Gaujoux et al, we observed a significant downregulation of TREM-1 in whole blood both at the protein and at the mRNA level at baseline in patients who will achieve mucosal healing after 6 months of therapy. Larger prospective cohorts are therefore warranted to identify a cut-off TREM1 mRNA level, prior to the translation into daily clinical practice.

Acknowledgments

The authors would like to thank Vera Ballet for an excellent job in maintaining the Leuven IBD patient database; Sophie Organe, Nooshin Ardeshir Davani, Helene Blevi, Tamara Coopmans and Willem-Jan Wollants for an excellent job in maintaining the Biobank database.

References

View Abstract

Footnotes

  • Contributors BV: study design, data acquisition and interpretation, statistical analysis and drafting of the manuscript. SaV: technical assistance qPCR and critical revision of the manuscript. HB: technical assistance ELISA. IC, MdB and GVA: critical revision of the manuscript. SV and MF: study design, data interpretation, supervision and critical revision of the manuscript. All authors agreed with the final version of the manuscript prior to submission.

  • Funding B Verstockt is a doctoral fellow and G Van Assche, S Vermeire and M Ferrante are Senior Clinical Investigators of the Research Foundation Flanders (FWO), Belgium. B Verstockt has also received research grants by the Belgium Week of Gastroenterology, the Belgian IBD Research and Development (BIRD), the European Crohn’s and Colitis Organization (ECCO) and the IBD Patient’s Association Flanders (CCV VZW).

  • Disclaimer The authors have no other relevant affiliations or financial involvement with any organisation or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript apart from those disclose.

  • Competing interests B Verstockt received lecture fees from Ferring and Takeda Pharmaceuticals. G Van Assche received financial support for research from Abbott and Ferring Pharmaceuticals; lecture fees from Janssen, MSD and Abbott; consultancy fees from PDL BioPharma, UCB Pharma, Sanofi-Aventis, Abbott, Abbvie, Ferring, Novartis, Biogen Idec, Janssen Biologics, NovoNordisk, Zealand Pharma A/S, Millenium/Takeda, Shire, Novartis and Bristol Mayer Squibb. S Vermeire received financial support for research from MSD, Abbvie, Janssen and UCB Pharma; lecture fees from Abbott,Abbvie, Merck Sharpe & Dohme, Ferring Pharmaceuticals and UCB Pharma; consultancy fees from Pfizer, Ferring Pharmaceuticals, Shire Pharmaceuticals Group, Merck Sharpe & Dohme, and AstraZeneca Pharmaceuticals. M Ferrante received financial support for research from Takeda and Janssen; lecture fees from Ferring, Boehringer- Ingelheim,Chiesi, Merck Sharpe & Dohme, Tillotts, Janssen Biologics, AbbvieTakeda, Mitsubishi Tanabe, Zeria; consultancy fees from Abbvie, Boehringer-Ingelheim, Ferring, Merck Sharpe & Dohme, and Janssen Biologics. SaV, HB, IC and MdB declare no conflicts of interest.

  • Patient consent Obtained.

  • Ethics approval All patients included in the analysis had given written consent to participate in the Institutional Review Board-approved IBD Biobank (B322201213950/S53684), collecting serum and clinical characteristics among other items.

  • Provenance and peer review Not commissioned; externally peer reviewed.

Request Permissions

If you wish to reuse any or all of this article please use the link below which will take you to the Copyright Clearance Center’s RightsLink service. You will be able to get a quick price and instant permission to reuse the content in many different ways.