Table 1

Sequences of primers used for PCR

Cytokine Sequence (5′–3′) Product size (bp)
β-actin
 SenseTGGAATCCTGTGGCATCCATGAAAC348
 AntisenseTAAAACGCAGCTCAG TAACAGTCCG
IL-1α
 SenseCTCTAGAGCACCATGCTACAGAC308
 AntisenseTGGAATCCAGGGGAAACACTG
IL-1β
 SenseTCATGGGATGATGATAACCTGCT502
 AntisenseCCCATACTTTAGGAAGACACGGATT
IL-4
 SenseATGGGTCTCAACCCCCAGCTAGT399
 AntisenseGCTCTTTAGGCTTTCCAGGAAGTC
IL-6
 SenseCTGGTGACAACCACGGCCTCCCCT600
 AntisenseATGCTTAGGCATAACGCACTAGGT
TNF-α
 SenseGGCAGGTCTACTTTGGAGTCATTGC307
 AntisenseACATTCGAGGCTCCAGTGAATTCGG
IFN-γ
 SenseTGAACGCTACACACTGCATCTTGG460
 AntisenseTGACTCCTTTTCCGCTTCCTGAG
IL-10
 SenseACCTGGTAGAAGTGATGCCCCAGGCA237
 AntisenseCTATGCAGTTGATGAAGATGTCAAA
TGF-β1
 SenseCCTCCCCCATGCCGCCCTCG545
 AntisenseCCAGGAATTGTTGCTATATTTCTG