Reaction number | Sense primer number | Sense primer sequence (5′–3′) | Nucleotide position | Antisense primer number | Antisense primer sequence (5′–3′) | Nucleotide position | Specificity | Product size (bp) |
1 | 805 | AGCTGTTCGTGTTCTATGATC | 388–408 | 807 | CTGGGTGCTCCACCTGGC | 1066–1083 | 63H–282C | 1460 |
2 | 805 | AGCTGTTCGTGTTCTATGATC | 388–408 | 808 | CTGGGTGCTCCACCTGGT | 1066–1083 | 63H–282Y | 1460 |
3 | 806 | AGCTGTTCGTGTTCTATGATG | 388–408 | 807 | CTGGGTGCTCCACCTGGC | 1066–1083 | 63D–282C | 1460 |
4 | 806 | AGCTGTTCGTGTTCTATGATG | 388–408 | 808 | CTGGGTGCTCCACCTGGT | 1066–1083 | 63D–282Y | 1460 |
5 | 805 | AGCTGTTCGTGTTCTATGATC | 388–408 | 835 | CTGTGGTTGTGATTTTCCATAA | 535–566 | 63H | 178 |
6 | 806 | AGCTGTTCGTGTTCTATGATG | 388–408 | 835 | CTGTGGTTGTGATTTTCCATAA | 535–566 | 63D | 178 |
7 | 834 | TTGGTGAAGGTGACACATCAT | 846–866 | 807 | CTGGGTGCTCCACCTGGC | 1066–1083 | 282C | 237 |
8 | 834 | TTGGTGAAGGTGACACATCAT | 846–866 | 808 | CTGGGTGCTCCACCTGGT | 1066–1083 | 282Y | 237 |
Control primers (reactions 1–4) | ||||||||
725 | GCCTTCCCAACCATTCCCTT | 726 | TCACGGATTTCTGTTGTGTTTC | HGH control | 425 |
Specificity of primers is determined by the underlined 3′ nucleotide. Primers 834 and 835 are consensus, non-allele specific primers. Nucleotides are numbered according to Feder et al1 (Genbank accession number U60319). The genomic sequence of HFE has not been published, but from the known sequence of HLA-A, codons 63 and 282 would lie in exons 2 and 4, respectively, separated by about 1460 nucleotides. Examples of reactions 1–4 only are given in fig 1.