Table 1

Human chemokine specific oligonucleotide primers for RT-PCR

Chemokine Primer Nucleotide cDNA (bp)
IL-8SenseGCTTTCTGATGGAAGAGAGC585
AntisenseGGCACAGTGGAACAAGGACT
GROαSenseTTGCAGACCCTGCAGGGAAT184
AntisenseTGGATTTGTCACTGTTCAGC
RANTESSenseTGCCTCCCATATTCCTCGG211
AntisenseCTAGCTCATCTCCAAAGA
MIP-1αSenseCCTTGCTGTCCTCCTCTGCA254
AntisenseCACTCAGCTCTAGGTCGCTG
MIP-1βSenseTGTCTCTCCTCATGCTAGTA233
AntisenseGTACTCCTGGACCCAGGAT
MCAFSenseCAATAGGAAGATCTCAGTGC188
AntisenseGTGTTCAAGTCTTCGGAGTT