Table 1

Primers used for polymerase chain reaction amplification of the core region of hepatitis C virus

PrimerSequence (5′–3′)Nucleotide
Universal external
 SenseCGCGCGACTAGGAAGACTTC139–158
 AntisenseATGTACCCCATGAGGTCGGC410–391
Internal
 Common senseAGGAAGACTTCCGAGCGGTC148–167
Type specific antisense
 Type 1aAGGAAGACTTCCGAGCGGTC196–177 (57 bp)
 Type 1bGAGCCATCCTGCCCACCCCA291–272 (144 bp)
 Type 2aCCAAGAGGGACGGGAACCTC321–302 (174 bp)
 Type 2bACCCTCGTTTCCGTACAGAG270–251 (123 bp)
Type 3a specific
 External senseCGCGCGACGCGTAAAACTTC139–158
 Internal senseCGTAAAACTTCTGAACGGTC148–167
 Internal antisenseGCTGAGCCCAGGACCGGTCT235–214