Sequences of the different oligonucleotide probes used in the present study
| Name | Sequence (5′-3′) | Target (rDNA position2-a) | Specificity |
| Hpy-1 | CACACCTGACTGACTATCCCG | 16S (585–605) | H pylori |
| Eub19 | GCTGCCTCCCGT | 16S (338–349) | Bacteria |
| ClaR1 | CGGGGTCTT C CCGTCTT | 23S (2136–2152) | A2143G (ClaR) |
| ClaR2 | CGGGGTCTCTCCGTCTT | 23S (2136–2152) | A2144G (ClaR) |
| ClaR3 | CGGGGTCTTGCCGTCTT | 23S (2136–2152) | A2143C (ClaR) |
| ClaWT | CGGGGTCTTTCCGTCTT | 23S (2136–2152) | wild type (ClaS) |
↵2-a Numbers for 16S rRNA sequence are according toE coli numbering, 23S rRNA sequences refer to H pylori numbers; 23S rDNA mutations leading to clarithromycin resistance are printed in bold and underlined.