Table 1

Polymerase chain reaction (PCR) for amplification of H pylori cagA, iceA, and vacA genes

RegionPrimerNucleotide sequence (5′→3′)Size of PCR product (bp)Reference
cagAcagA-FAATACACCAACGCCTCCAAG400 22
cagA-RTTGTTGCCGCTTTTGCTCTC
iceA1iceA1-FGTGTTTTTAACCAAAGTATC2469
iceA1-RCTATAGCCAGTCTCTTTGCA
iceA2iceA2-FGTTGGGTATATCACAATTTAT229 or 3349
iceA2-RTTGCCCTATTTTCTAGTAGGT
m1m1-FGGTCAAAATGCGGTCATGG290 23
m1-RCCATTGGTACCTGTAGAAAC
m2m2-FGGAGCCCCAGGAAACATTG352 23
m2-RCATAACTAGCGCCTTGCAC
m1Tm1T-FGGCCACAATGCAGTCATGG2906
m1T-RCTCTTAGTGCCTAAAGAAACA
m1Tm2m1T-FGGCCACAATGCAGTCATGG3006
m2-RCATAACTAGCGCCTTGCAC
s1as1a-FGTCAGCATCACACCGCAAC190 23
s-RCTGCTTGAATGCGCCAAAC
s1bs1b-FAGCGCCATACCGCAAGAG187 23
s-RCTGCTTGAATGCGCCAAAC
s2s2-FGCTTAACACGCCAAATGATCC199 23
s-RCTGCTTGAATGCGCCAAAC