Table 2

Oligonucleotide primer sequences of three measles virus genes used in the NIBSC study

Gene Designation Position Sequence (5′ →3′)
NMV1/outer1198–1218TTAGGGCAAGAGATGGTAAGG
NMV2/outer1609–1630GTTCTTCCGAGATTCCTGCCA
NMV3/inner1248–1268AGCATCTGAACTCGGTATCAC
NMV4/inner1480–1500AGCCCTCGCATCACTTGCTCT
MMV13/outer3565–3584GCGACAGGAAGGATGAATGC
MMV14/outer3832–3851GTTTGCGTTGAAAGACACTCC
MMV15/inner3587–3603TATGTACATGTTTCTGC
MMV16/inner3811–3829GTTGTTAGGACCTTTCTCC
HMV-M3/outer8106–8125CAGTCAGTAATGATCTCAGC
HMV-M6/outer8676–8701CTTGAATCTCGGTATCCACTCCAAT
HMV-H7/inner8147–8171GAGCTCAAACTCGCAGCCCTTTGTC
HMV-H4A/inner8457–8482ATCCTTCAATGGTGCCCACTCGGGA
  • The nucleotide positions are in relation to the sequence reported for the measles virus genome in the EMBL-Genbank data under accession number K01711.

  • N, nucleocapsid protein gene; M, matrix protein gene; H, haemagglutinin protein gene.