Table 4

 Real time polymerase chain reaction primers used to quantitate mRNA/rRNA levels in rectal biopsies

Gene targetPrimer pair 5′ to 3′
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH)GGAAGGTGAAGGTCGGAGTC
CTCAGCCTTGACGGTGCCATG
Human beta defensin 1 (hBD1)CTCTGTCAGCTCAGCCTC
CTTGCAGCACTTGGCCTTCCC
Human beta defensin 2 (hBD2)CCAGCCATCAGCCATGAGGGT
GGAGCCCTTTCTGAATCCGCA
Human beta defensin 3 (hBD3)CGGCCACGCGTCGAGCACTTG
CTCCTTTGGAAGGCAGCTGAG
Human beta defensin 4 (hBD4)GTGGAGCCATATGTCATC
CTGAATCCGCATCAGCC
Interleukin 1α (IL-1α)ATGGCCAAAGTTCCAGACATGTTT
TTGGTCTTCATCTTGGGCAGTCAC
Tumour necrosis factor 1α (TNF-α)TCTCGAACCCCGAGTGACAA
TATCTCTCAGCTCCACGCCA
Interleukin 10 (IL-10)TCAGGGTGGCGACTCTAT
GTCCGGGGTGCATTATCTCTACAGT
Bifidobacterial genus specificAGGGTTCGATTCTGGCTCAG
CATCCGGCATTACCACCC