Table 2

 Primers and probes for quantitative real time polymerase chain reaction

Target gene5′-primerProbe3′-primer
Probes were labelled with the reporter dye FAM at the 5′-end and with the quencher molecule TAMRA at the 3′-end. 5′- and 3′-primers were designed to span exon-intron boundaries to minimise the amplification of genomic DNA.
BaxGTCCACCAAGAAGCTGAGCGGAGCTGCAGAGGATGATTGCCGCCTCGGAAAAAGACCTCTCGGG
Bcl-2CCTGGTGGACAACATCGCCAACGGAGGCTGGGATGCCTTTGTGAATCAAACAGAGGCCGCATGC
β2-microglobulinTGACTTTGTCACAGCCCAAGATATGATGCTGCTTACATGTCTCGATCCCAAATCCAAATGCGGCATCTTC