Table 1

 Sequences of primer pairs used for real time polymerase chain reaction assays

GeneAccession NoPrimer sense (5′-3′)Primer antisense (5′-3′)
IL, interleukin; TIMP-1, tissue inhibitor of metalloproteinase; TGF-β1, transforming growth factor β1; CTGF, connective tissue growth factor; KLF-6, Kruppel-like factor 6; MCP-1, monocyte chemoattractant protein.
CD36NM_0331561GGACCATCGGCGATGAGAACCAGGCCCAGGAGCTTTAT
CINC (IL-8)NM_138522ATTTTGAGAACATCCAGAGCTTGACCATCCTTGAGAGTGGCTATGAC
Coll α1Z78279TTCACCTACAGCACGCTTGTGTCTTGGTGGTTTTGTATTCGATGA
CTGFNM_022266CGCCAACCGCAAGATTGACACGGACCCACCGAAGAC
IL-1βNM_031512GGGTTGAATCTATACCTGTCCTGTGTAACCGCTTTTCCATCTTCTTCTT
IL-6M26744GCCCTTCAGGAACAGCTATGATGTCAACAACATCAGTCCCAAGA
KLF-6AF001417TGTAGCATCTTCCAGGAACTACAGATGACACGTAGCAGGGCTCACT
MCP-1M57441CCACTCACCTGCTGCTACTCATCTGCTGCTGGTGATTCTCTTGT
RPL19M30264.1CAAGCGGATTCTCATGGAGCATGGTCAGCCAGTAGCTTCTT
TGF-β1NM_021578TCGACATGGAGCTGGTGAAAGAGCCTTAGTTTGGACAGGATCTG
TIMP-1NM_053819AAGGGCTACCAGAGCGATCAGGTATTGCCAGGTGCACAAAT