Table 2

 Sequence of primers and probe: primers for reverse transcriptase polymerase chain reaction

Accession numbersForward primerReverse primerLengthCycle
Synemin (α+β)GCAAGACGAGATTGCACAGGCCATTAAGGTCACAGAACCGC40430
Synemin (α)Dr Z LI, personal communicationCCCACAGACATTGGGATTTAGGCACCCATCTGAAAGGTAAATGAAGTT40130
Synemin (β)NM_182737GAAGGATGATACTGACCGGGTCGTCTTGTCAAATCCAGCCTGCT42630
GFAPNM_017009TGGCCACCAGTAACATGCAGACTCCTTAATGACCTCGCCAT53832
DesminNM_022531AGACTTGACTCAGGCAGCCAATCGGAAGTTGAGAGCAGAGAAGG38425
VimentinNM_031140CGCCAGCAGTATGAAAGTGTGAGTGGGTGTCAACCAGAGGAA49625
18srRNAAY248756GAGGTGAAATTCTTGGACCGGTGGCTGAACGCCACTTGTC51320