Table 3

 Sequence of primers and probe: primers and probes for quantitative reverse transcriptase polymerase chain reaction

Forward primerProbeReverse primer
Synemin (α+β)CGGATGCGCGAGGAGTACTCACTCTCTGCCGCTCCTGGTAAGGGCATCCTTCTCATCCT
Synemin (α)GCAGTAGCACACCATGTCACATTTGGGCCCCAGTGCAAGTCACTTACACCCATCTGAAAGGT
Synemin (β)CCTACGGAGGACCCACCTCACCCATCTCCACCACCGGGGATGGCTCTCGTGTCACTTA