Table 1

 Primers and probes used in this study

Target organisms (amplicon size)Primer/probeSequence (5′-3′)Tm (°C)Reference
Bifidobacterium spp (126 bp).Forward primerGCGTGCTTAACACATGCAAGTC59Penders et al26
Reverse primerCACCCGTTTCCAGGAGCTATT59Penders et al26
ProbeTCACGCATTACTCACCCGTTCGCC70Penders et al26
Escherichia coli (96 bp)Forward primerCATGCCGCGTGTATGAAGAA59Huijsdens et al27
Reverse primerCGGGTAACGTCAATGAGCAAA59Huijsdens et al27
ProbeTATTAACTTTACTCCCTTCCTCCCCGCTGAA68Huijsdens et al27
Clostridium difficile (114 bp)Forward primerTTGAGCGATTTACTTCGGTAAAGA58Penders et al26
Reverse primerTGTACTGGCTCACCTTTGATATTCA59Penders et al26
ProbeCCACGCGTTACTCACCCGTCCG69Penders et al26
Bacteroides fragilis group (92 bp)Forward primerCGGAGGATCCGAGCGTTA58Penders et al25
Reverse primerCCGCAAACTTTCACAACTGACTTA59Liu et al28
ProbeCGCTCCCTTTAAACCCAATAAATCCGG68Penders et al25
Lactobacillus spp (341 bp)Forward primerAGCAGTAGGGAATCTTCCA59Walter et al,29 Rinttila et al30
Reverse primerCACCGCTACACATGGAG59Rinttila et al,30 Heilig et al31
Total count (467 bp)Forward primerTCCTACGGGAGGCAGCAGT59Nadkarni et al32
Reverse primerGGACTACCAGGGTATCTAATCCTGTT58Nadkarni et al32