Table 2 Primer sequences, annealing temperature and expected size of amplified products for polymerase chain reaction (PCR) analysis
GeneAccession numberPrimer (forward/reverse)Annealing temperatureProduct size (bp)
AFPNM_001134fw TGCAGCCAAAGTGAAGAGGGAAGA55°C216
rv ATAGCGAGCAGCCCAAAGAAGAA
AlbuminNM_000477fw GCTGCCATGGAGATCTGCTTGA55°C174
rv GCAAGTCAGCAGGCATCTCATC
ChromANM_001275fw CGCGCCTTGTCTCCTACTC50°C254
rv AGGAAAGAGCCCAGAACAGAT
CK7NM_005556fw TCCGCGAGGTCACCATTAAC55°C218
rv GCTGCTCTTGGCCGACTTCT
CK14NM_000526fw GGGCGGCCTGTCTGTCTC60°C237
rv AGGCGGTCATTGAGGTTCTG
CK18NM_000224fw CCCGCTACGCCCTACAGA53°C248
rv GCGGGTGGTGGTCTTTTG
CK19NM_002276fw CGAGCAGAACCGGAAGGATG53°C318
rv AGCCGCTGGTACTCCTGATTC
NestinNM_006617fw GGGGGCAATGAATCCTCTAG50°C295
rv CACCGTATCTTCCCACCTCTG
β-ActinNM_001101fw GCCGGGACCTGACTGACTAC53°C327
rv TGCGGATGTCCACGTCAC
  • AFP, alpha-fetoprotein; fw, forward; rv, reverse.