Table 2

PCR primers used for methylation-specific PCR (MS-PCR) and quantification of mRNA abundance of target genes

The primers sequences for methylation-specific PCR
GeneForward primer 5′→3′Reverse primer 5′→3′
 MT-ND6-MTTTCGTATTAATAGGATTTTTTCGAAATTATCTTTAAATATACTACAACGAT
 MT-ND6-UTTTTGTATTAATAGGATTTTTTTGAATAATTATCTTTAAATATACTACAACAAT
 MT-CO1-MGGAATATTATATTTATTATTCGGCGTACTAATCAATTACCAAAACCTCCG
 MT-CO1-UTGGAATATTATATTTATTATTTGGTGTCTAATCAATTACCAAAACCTCCAAT
 D-loop-MTAGGAATTAAAGATAGATATTGCGAACTCTCCATACATTTAATATTTTCGTC
 D-loop-UGGTAGGAATTAAAGATAGATATTGTGAACTCTCCATACATTTAATATTTTCATC
The primer sequences for mRNA gene expression
GeneForward primer 5′→3′Reverse primer 5′→3′
 MT-ND6AATAATTTATGAAGGAGAGGCAAACAATGTTCAACCAGTA
 MT-CO1ACAGACCGCAACCTCAACACAGCCTGGTAGGATAAGAATA
 MTRNR2ACTAACCCCTATACCTTCTGTTCCCACTATTTTGCTACAT
 DNMT1CATGGCCGGCTCCGTTCCATAGCTGTCTCTTTCCAAATCTTTGA
 Β-actinCTG GCA CCC AGC ACA ATG AAGAAA GGG TGT AAC GCA ACT AAG