Table 2

Sequences of the human primers used for real-time PCR (always in 5′≥3′ orientation)

Target geneForward sequenceReverse sequence
β2 MicroglobulinGACTTGTCTTTCAGCAAGGAACAAAGTCACATGGTTCACA
Col1a1GTGCGATGACGTGATCTGTGACGGTGGTTTCTTGGTCGGT