Article Text
Abstract
Objectives Autoimmune hepatitis (AIH) is a severe necroinflammatory liver disease associated with significant mortality. Although loss of hepatocytes is generally recognised as a key trigger of liver inflammation and liver failure, the regulation of hepatic cell death causing AIH remains poorly understood. The aim of this study was to identify molecular mechanisms that drive hepatocyte cell death in the pathogenesis of acute liver injury.
Design Acute liver injury was modelled in mice by intravenous administration of concanavalin A (ConA). Liver injury was demonstrated by serum transaminases and histological assessment of liver sections. PGAM5-deficient mice (PGAM5−/−) were used to determine its role in experimental hepatitis. Mdivi-1 was used as an inhibitor of dynamin-related protein 1 (Drp1)-mediated mitochondrial fission. Mitochondrial fission and the expression of PGAM5 were compared between liver biopsies derived from patients with AIH and control patients.
Results PGAM5 was highly expressed in hepatocytes of patients with AIH and in mice with ConA-induced experimental hepatitis. Deficiency of PGAM5 protected mice from ConA-induced hepatocellular death and liver injury. PGAM5 regulated ConA-induced mitochondrial fission in hepatocytes. Administration of the Drp1-inhibitor Mdivi-1 blocked mitochondrial fission, diminished hepatocyte cell death and attenuated liver tissue damage induced by ConA.
Conclusions Our data demonstrate for the first time that PGAM5 plays an indispensable role in the pathogenesis of ConA-induced liver injury. Downstream of PGAM5, Drp1-mediated mitochondrial fission is an obligatory step that drives the execution of hepatic necrosis and tissue damage. Our data highlight the PGAM5-Drp1 axis as a potential therapeutic target for acute immune-mediated liver injury.
- CELL DEATH
- ACUTE LIVER FAILURE
- AUTOIMMUNE HEPATITIS
- HEPATOCYTE
Statistics from Altmetric.com
Significance of this study
What is already known on this subject?
Hepatocyte necrosis represents a histological feature and a key trigger of disease progression of human autoimmune hepatitis (AIH).
PGAM5 plays an important role in mitochondrial homeostasis and multiple necrotic death pathways.
Dynamin-related protein 1 (Drp1) has been identified as a substrate of PGAM5 in vitro.
What are the new findings?
Mitochondrial dysregulation and altered PGAM5 expression were found in hepatocytes of patients with AIH and in experimental immune-mediated liver injury in mice.
PGAM5 is strictly required for concanavalin A (ConA)-induced hepatic necrosis and liver damage.
PGAM5 regulates ConA-induced mitochondrial fission in hepatocytes.
Blockade of Drp1-mediated mitochondrial fission by Mdivi-1 protects mice from experimental immune-mediated liver injury.
How might it impact on clinical practice in the foreseeable future?
Our findings uncover a novel mechanism for PGAM5-mediated necrosis in the pathogenesis of immune-mediated liver injury. This has important clinical implications since Drp1-mediated mitochondrial fission is druggable. Future therapeutic strategies for AIH might benefit from targeting necrosis as an alternative or in combination with immunosuppression.
Introduction
Liver injury and hepatocyte cell death are common features of all liver diseases. Liver injury can be caused by various stimuli such as alcohol consumption, infection, drug abuse and autoimmunity. Autoimmune hepatitis (AIH) is a progressive liver disease of unknown cause associated with liver failure and significant mortality.1 Pathogenically, AIH is characterised by an immune-mediated destruction of hepatocytes leading to progressive necroinflammation in the liver. Despite the fact that hepatocyte necrosis represents a histological feature and a key trigger of disease progression, the precise mechanism of cell death regulation remains poorly understood.2
Administration of concanavalin A (ConA), a lectin originally extracted from the jack bean has been widely used to model immune-mediated liver injury in mice. ConA-induced liver injury is characterised by activation of T cells and cytokine release, tissue necrosis and severe liver inflammation accompanied by elevated serum transaminases, thereby mimicking clinical features of human AIH.3 ,4 ConA treatment primarily induces necrotic cell death in hepatocytes, which cannot be prevented by administration of caspase inhibitors or by using apoptosis-resistant mice expressing a mutant fas associated via death domain (FADD).5 ,6 Therefore, ConA administration can serve as a model to investigate the programming of necrotic cell death in hepatocytes during inflammatory liver disease.
Recently, the mitochondrial phosphoglycerate mutase/protein phosphatase (PGAM5) was identified to play an important role in mitochondrial homeostasis and multiple necrotic death pathways.7–10 Mitochondrial dysregulation has been previously associated with a variety of liver diseases.11 In a context-dependent manner, PGAM5 regulates mitochondrial dynamics via two opposing processes, mitophagy and mitochondrial fission.7–9 Mitochondrial fission produces spherical mitochondria and induces significant cristae remodelling, which is characterised by fragmentation and the disappearance of cristae membranes.12 Dynamin-related protein 1 (Drp1), a large GTPase, plays a central role in mitochondrial fission in mammalian cells.13 On phosphorylation at Ser616, activated Drp1 oligomerises and translocates from the cytosol to punctuate spots at division sites around the outer mitochondrial membrane, where it drives the fission process.14 ,15 Emerging evidence indicates that mitochondrial fission is an early and causal event in necrotic cell death.7 ,16 ,17 Accordingly, PGAM5 was proposed to function at the convergent point for other necrotic death pathways, as knockdown of PGAM5 in cell lines protected against reactive oxidative species (ROS) and calcium overload-induced necrosis.7 However, it is currently unknown whether the mitochondrial PGAM5 plays a role in regulating hepatocyte necrosis and immune-mediated liver injury.
Here, we show for the first time that PGAM5 expression and Drp1-mediated mitochondrial fission are activated in hepatocytes from humans with AIH and mice with experimental hepatitis. Using PGAM5 knockout mice, we identified that PGAM5 is strictly required for ConA-induced hepatic necrosis and liver damage. On the molecular level, we discovered Drp1-mediated mitochondrial fission as a critical step downstream of PGAM5 in hepatocellular necrosis and liver injury. Collectively, we uncovered a critical role of the PGAM5-Drp1-mitochondrial fission axis in hepatic necrosis during the pathogenesis of immune-mediated liver injury.
Materials and methods
Animal models
PGAM5−/− mice were obtained from the International Knockout Mouse Consortium. For the induction of necrosis-mediated liver injury, 25 mg/kg of ConA (Sigma-Aldrich) was administered intravenously and mice were sacrificed 7 hours later unless specifically indicated. For apoptosis-mediated liver injury, 0.25 mg/kg of anti-CD95 antibody (Jo2) was administered intravenously and mice were sacrificed 6 hours later. Plasma concentrations of aspartat transaminase (AST) and alanine transaminase (ALT) were measured in the clinical chemistry unit of the University Medical Center Erlangen. In some experiments, Mdivi-1 (50 mg/kg) was injected intraperitoneally 30 min before ConA treatment. Stock solution of Mdivi-1 was prepared in dimethyl sulfoxide (DMSO) (final concentration 0.5%). Animal protocols were approved by the Institutional Animal Care and Use Committee of the University of Erlangen.
Histology and immunohistochemistry
Histopathological analyses were performed on formalin-fixed paraffin-embedded tissue after Mayer's H&E staining. Immunofluorescence was performed using the TSA Cy3 system as recommended by the manufacturer (PerkinElmer). The following antibodies were used: Tomm20 (Sigma), CD4 (eBioscience), PGAM5 and myeloperoxidase (MPO) (Abcam), pDrp1 (Ser616), cleaved caspase-3 (Cell Signaling). Cell death was analysed using the in situ cell death detection kit (Roche). Nuclei were counterstained with Hoechst 3342 (Invitrogen). Images were obtained using fluorescence microscopy (Leica TCS SP5 II, Leica DMI 4000B). Transmission electron microscopic (TEM) samples were fixed in Sörensen's buffer pH 7.0 and pictures were obtained using electron microscopy (Zeiss).
Immunoblotting
Proteins were isolated from liver biopsies using Mammalian Protein Extraction reagent (Thermo Scientific, Logan, Utah, USA) supplemented with protease inhibitors (Complete, Roche) and phosphatase inhibitors (PhosphoStop, Roche). Proteins were separated using a MiniProtean-tris-glycine extended (TGX) gel (4%–15% polyacrylamide; BioRad) and transferred from the gel to a nitrocellulose membrane (Whatman). Membranes were probed with the following primary antibodies: pSTAT1 (Tyr701), STAT1 (Cell Signaling), PGAM5 (Sigma) and β-actin (Abcam). Horseradish peroxidase (HRP)-linked anti-rabbit (Cell Signaling) was used as a secondary antibody.
Gene expression
Total RNA was extracted from liver tissue using the peqGOLD Total RNA Kit (Peqlab, Erlangen, Germany). cDNA was synthesised using the SCRIPT cDNA Synthesis Kit from Jena Bioscience and analysed by real-time PCR using specific QuantiTect Primer assays (Qiagen). Experimental values were normalised to levels of the housekeeping gene hypoxanthine guanine phosphoribosyl transferase.
mtDNA analysis
Total DNA was isolated from liver tissues using peqGOLD Tissue DNA Mini Kit (peQlab). Quantitative PCR was performed using nuclear DNA primers (Tert) and mitochondrial DNA (mtDNA) primers (Dloop1, Dloop2, Dloop3, ND4, CytB). The relative abundance of mtDNA was normalised to levels of nuclear DNA. Primers used in qPCR (forward/reverse) are as follows:
nuc-Tert:CTAGCTCATGTGTCAAGACCCTCTT/GCCAGCACGTTTCTCTCGTT;
mtDloop1: AATCTACCATCCTCCGTGAAACC/TCAGTTTAGCTACCCCCAAGTTTAA;
mtDloop2: CCCTTCCCCATTTGGTCT/TGGTTTCACGGAGGATGG;
mtDloop3: TCCTCCGTGAAACCAACAA/AGCGAGAAGAGGGGCATT;
mtDn4: AACGGATCCACAGCCGTA/AGTCCTCGGGCCATGATT;
mtCytB: GCTTTCCACTTCATCTTACCATTTA/TGTTGGGTTGTTTGATCCTG
Cytokine measurements
For cytokine release, splenocytes were cultured in Roswell Park Memorial Institute (RPMI) supplemented with anti-CD3 (10 µg/mL, Bio-X-Cell) and anti-CD28 (10 µg/mL) for 24 hours. For determination of mouse interferon (IFN) γ, the IFN-γ specific DuoSet ELISA Kit (R&D Systems) was used according to the manufacturer's instructions.
Human samples
All studies with human material were approved by the ethics committee of the University Hospital of Erlangen. The diagnosis of AIH was defined according to the guidelines of the European Association for the Study of Liver Disease guidelines.18 Other conditions that may cause hepatitis, including viral, drug-induced, cholestatic, metabolic and hereditary disorders, have been excluded in these patients.
Statistical analysis
Statistical analysis was performed using the two-tailed Student's t-test. N.S. p>0.05; *p≤0.05; **p≤0.01; ***p≤0.001; +SD.
Results
Mitochondrial dysregulation and altered PGAM5 expression in hepatocytes of patients with AIH and in experimental hepatitis in mice
To test whether inflammatory liver disease is associated with mitochondrial dysregulation, we initially stained liver biopsies from patients with AIH with Tomm20, an outer mitochondrial membrane protein. In liver samples from patients with AIH, Tomm20 staining showed a strong perinuclear aggregation of the mitochondria, a characteristic indicator of mitochondrial stress (figure 1A, upper panel). In contrast, mitochondria were found equally distributed in the cytoplasm of hepatocytes of liver from control patients (figure1A, upper panel). Strikingly, a similar pattern of mitochondrial abnormality was observed in livers derived from mice subjected to ConA treatment, a well-established experimental model of immune-mediated hepatitis (figure 1A, lower panel). These findings indicated that inflammatory liver disease in both humans and mice shows characteristic features of mitochondrial dysfunction. Mitochondrial homeostasis has recently been reported to be regulated by the mitochondrial phosphatase PGAM5.7–9 To further investigate the cause of mitochondrial alterations observed in samples from patients with AIH and in experimental hepatitis in mice, we next analysed the expression and localisation of PGAM5 in these samples. Interestingly, as compared with control individuals, hepatic PGAM5 mRNA levels were strongly elevated in patients suffering from AIH but not in other clinical manifestations of liver disease including steatosis, drug-induced liver injury and chronic HCV infection (figure 1B, left panel). Moreover, immunostaining confirmed an enhanced expression of PGAM5 in paraffin sections of liver biopsies from patients with AIH (figure 1B, right panel). Similarly, western blotting and immunostaining showed that ConA-induced liver inflammation was associated with elevated levels of PGAM5 protein in liver tissues (figure 1C). Importantly, costaining of PGAM5 or Tomm20 with albumin, a hepatocyte-specific marker, showed that mitochondrial aggregation and PGAM5 staining predominantly occurred in hepatocytes implicating that mitochondrial alterations occur in hepatocytes rather than immune cells (figure 1D). Strikingly, the increment of PGAM5 protein in samples of injured liver was more pronounced in necrotic areas labelled with TdT-mediated dUTP-biotin nick end labeling (TUNEL) (figure 1E) suggesting that PGAM5 might be linked to hepatocyte cell death. Collectively, our data indicate that mitochondrial aggregation and PGAM5 expression are strongly increased in hepatocytes of both patients with AIH and mice with experimental liver inflammation.
PGAM5 deficiency protects mice from ConA-induced hepatocellular necrosis and liver injury
To study a functional contribution of PGAM5 to the development of immune-mediated liver injury, we took advantage of PGAM5-deficient mice (figure 2A). Accordingly, PGAM5-deficient mice and control mice were subjected to ConA treatment. Intriguingly, PGAM5−/− mice were almost completely protected from ConA-induced liver injury as indicated by diminished plasma AST and ALT levels when compared with ConA-treated wild-type animals (see figure 2B and online supplementary figure S1a). Moreover, histological assessment of liver tissue further confirmed extensive necrotic tissue damage in wild type but not in PGAM5−/− mice (see figure 2C and online supplementary figure S1b). Along the same line, numbers of TUNEL positive cells were significantly reduced in PGAM5-deficient animals and almost equal to the level of unchallenged mice (see figure 2D, E and online supplementary figure S1c). Collectively, our data demonstrate that PGAM5 is required for organ pathology and hepatocyte necrosis in ConA-induced experimental liver inflammation.
Supplementary figures
To test the specificity of PGAM5 in necrosis-driven liver injury, we next subjected PGAM5−/− mice to treatment with anti-CD95 antibody (Jo2), which causes liver injury that is characterised by apoptosis rather than necrosis of hepatocytes.19 Intriguingly, plasma AST and ALT levels and histochemical analysis of liver tissues showed a similar level of liver damage and hepatocyte cell death in wild type (WT) and PGAM5−/− mice treated with Jo2 (see online supplementary figure S2). Additionally, WT and PGAM5-deficient mice were equally susceptible to a second model of hepatic apoptosis and liver injury induced by D-galactosamine and lipopolysaccharide (data not shown). Taken together, these data imply that PGAM5 is essential for hepatocellular necrosis, but not for apoptosis. Inflammatory cells, particularly T cells, play a central role in the pathogenesis of human AIH as well as in ConA-induced experimental hepatitis.3 ,18 T cells activated by ConA produce high levels of cytokines, including IFN-γ, tumour necrosis factor (TNF) α and interleukin (IL) 2.20 IFN-γ-STAT1 signalling is essential for experimental ConA-mediated hepatitis both via activation of T cells and by directly inducing hepatocyte death.21 However, loss of PGAM5 had no effect on the accumulation of T cells and neutrophils in the liver after injection of ConA (figure 3A). To rule out that PGAM5 deficiency might compromise T-cell activation, we compared cytokine signalling between control and PGAM5-deficient mice. Expression of IFN-γ, TNFα and IL-2 was markedly increased in liver samples of ConA-treated mice when compared with untreated controls. However, cytokine mRNA levels were comparable in WT and PGAM5−/− mice both under unchallenged conditions and on treatment with ConA (figure 3B). Moreover, the level of STAT1 activation in liver samples from PGAM5−/− mice was comparable to WT mice, implying that PGAM5 deficiency protects mice from ConA-induced liver injury in a STAT1-independent manner (figure 3C). In further support of this conclusion, splenocytes from control and ConA-injected mice secreted comparable amounts of IFN-γ on stimulation with anti-CD3/ anti-CD28 in vitro (figure 3D). Collectively, these data imply that PGAM5 deficiency protects mice from ConA-induced liver injury downstream of inflammatory cells infiltration and activation.
PGAM5 regulates ConA-induced mitochondrial fission in hepatocytes
We hypothesised that PGAM5 may mediate liver injury through a hepatocyte-autonomous mechanisms dependent on mitochondrial dysfunction. To further evaluate this hypothesis, we performed morphological analyses of mitochondria in liver tissue derived from WT mice and PGAM5−/− mice treated with or without ConA. Indeed, TEM pictures revealed aggregation of spherical mitochondria and mitochondria with loss of cristae membranes in hepatocytes of liver from WT mice treated with ConA but not in PBS-treated WT mice (figure 4A, upper panel). Strikingly, these mitochondrial alterations were undetectable in TEM pictures from ConA-treated PGAM5−/− mice. Tomm20 staining confirmed this observation (figure 4A, lower panel). Mitochondrial fragmentation and loss of cristae membranes have been widely used as an indicator of excessive mitochondrial fission associated with cell death. Of note, western blot of Tomm20 and quantitative PCR analysis of mtDNA indicated that ConA-induced liver injury is not associated with changes in the mass of mitochondria in liver (figure 4B). Therefore, our data indicated that ConA triggers mitochondrial fission in hepatocytes in a PGAM5-dependent manner. To further investigate the molecular mechanism of PGAM5-mediated mitochondrial fission in ConA-induced liver damage, we next analysed the expression and activation of Drp1, which has been previously described in vitro as a substrate of PGAM5 during the process of mitochondrial fragmentation.7 Phosphorylation of Drp1 at S616 is a critical step in the process of mitochondrial fission.12 In agreement with our hypothesis, ConA treatment of WT mice resulted in liver pathology with strong clustering of pDrp1 (S616) into large foci, while the overall expression level of Drp1 was unchanged (figure 4C and data not shown). In line with the results from TEM analyses and Tomm20 staining, PGAM5 deficiency blocked the formation of pDrp1 (S616) foci induced by ConA, indicating a critical role of PGAM5 in Drp1 activation during ConA-induced liver injury (figure 4C). Importantly, costaining with TUNEL showed that pDrp1 (S616) foci were particularly enriched in TUNEL-positive hepatocytes of necrotic areas, as well as TUNEL-negative hepatocytes located at the border of necrotic and non-necrotic areas, suggesting that Drp1 activation precedes cell death (figure 4D). To evaluate the relevance of Drp1-mediated mitochondrial fission to human liver pathology, we stained liver biopsies from patients with AIH with Tomm20 and pDrp1 (S616). In agreement with data from ConA-treated mice, we could observe a strong activation and clustering of pDrp1 (S616) in AIH liver samples (figure 4E). Furthermore, costaining of pDrp1 (S616) and Tomm20 demonstrated that activated Drp1 foci colocalised with mitochondria in hepatocytes, implying that mitochondrial fission might be relevant to human AIH (figure 4F). Taken together, these results suggest that Drp1 activation and mitochondrial fission are early events in human AIH and in experimental hepatitis in mice and that these events require the protein function of PGAM5.
Blocking of PGAM5-dependent Drp1 activation protects mice from experimental hepatitis
Drp1-mediated mitochondrial fission has been discussed to be an early event in some modes of necrotic cell death.22 To further evaluate whether mitochondrial fission directly drives ConA-induced liver damage, we took advantage of Mdivi-1, a specific inhibitor of Drp1.23 In contrast to DMSO, preadministration of Mdivi-1 to WT mice resulted in a strongly diminished increase in plasma ALT and AST levels after ConA challenge (figure 5A). Moreover, histological assessments and TUNEL staining showed that Mdivi-1 treatment attenuated liver tissue damage and significantly diminished cell death (figure 5B, C). However, pretreatment with Mdivi-1 had no effect on the accumulation of T cells and neutrophils in the liver, implying that inhibition of Drp1 protects from ConA-induced liver injury downstream of inflammatory cells infiltration (see online supplementary figure S3). Importantly, Mdivi-1 blocked mitochondrial fission as demonstrated by TEM analysis (figure 5D). Immunohistochemical analysis of liver tissue from Mdivi-1-treated mice indicated decreased formation of large pDrp1 (S616) foci and Tomm20 aggregates (figure 5E). Of note, Mdivi-1 pretreatment had no effect on ConA-induced upregulation of PGAM5, which further supports our previous observation that PGAM5 functions upstream of Drp1-mediated mitochondrial fission (figure 5F). Finally, pretreatment with Mdivi-1 did not show additive protection to PGAM5 deficiency in ConA-induced liver injury (see online supplementary figure S4). Collectively, these data clearly indicate that Drp-1-mediated mitochondrial fission is an obligatory step that drives the execution of hepatocyte necrosis and leads to liver injury induced by ConA.
Discussion
Although loss of hepatocytes acts as a common pathogenic mechanism in almost all types of human liver disease, modalities of hepatocellular death differ substantially between these diseases.2 In AIH, clinical data and animal models suggest that hepatic necrosis is the key trigger of disease progression.24 ,25 However, the pathogenic mechanisms of cell death regulation in AIH are only poorly understood. Here, we identified the mitochondrial phosphatase PGAM5 as a central mediator of hepatocellular death in a murine model of immune-mediated liver injury. On a molecular level, we further unravelled that PGAM5 regulated activation of the Drp1-mediated mitochondrial fission as an obligatory step for necrosis execution in hepatocytes. Targeting Drp1 markedly improved ConA-induced liver damage. Finally, in a translational approach using liver biopsies from patients with AIH, we demonstrated enhanced expression of PGAM5, activation of Drp1 and mitochondrial fission in areas of hepatocellular necrosis.
It is now clear that necrotic cell death can occur in a highly regulated and genetically controlled manner, termed regulated necrosis. Receptor-interacting protein kinase RIPK1–RIPK3 and mixed lineage kinase domain-like-mediated necroptosis has been identified as the prototype form of regulated necrosis, which takes place on death receptor activation in conditions where apoptosis is blocked.22 Although systemic administration of Necrostatin-1 (Nec-1), a specific RIPK1 inhibitor, or general deficiency in RIPK3 has been descripted to attenuate ConA-induced hepatitis,26 many studies have recently questioned the role of hepatic necroptosis in this process.27 ,28 Therefore, the physiological relevance of RIPK3-mediated necroptosis in immune-mediated liver injury remains elusive and the identification of non-necroptotic pathways of programmed necrosis is of fundamental importance to better understand the pathophysiology of these diseases.
PGAM5 has been proposed to function at the convergent point in multiple necrotic cell death pathways.7 Though identified as a direct target of RIPK3, the role of PGAM5 in necroptosis has been questioned by several recent studies.27 ,28 In own experiments, we found that PGAM5 is not involved in the execution of the canonical necroptosis pathway (data not shown). Therefore, PGAM5-mediated necrosis in hepatocytes might indeed represent a novel form of programmed necrosis.
A study published very recently indicated a cell death dispensable role of PGAM5 in natural killer T-cells (NKT) cells on stimulation with α-galactosylceramide in vitro.29 However, the role of PGAM5 in vivo in liver injury was not reported, as PGAM5-deficient mice were not included in this study.29 Our results clearly demonstrate that PGAM5 is upregulated specifically in hepatocytes on ConA treatment and that this upregulation was confined to necrotic areas. Along the same line, ConA-induced Drp1 activation and mitochondrial fission were observed in hepatocytes rather than immune cells, again pointing to a hepatocyte-specific function of this pathway. In our experimental models, neither cytokine expression nor STAT1 activation was altered in ConA-treated PGAM5 deficient mice when compared with controls. Therefore, our data for the first time uncover PGAM5-mediated necrosis as a hepatocyte-autonomous mechanism in ConA-induced experimental hepatitis.
The identification of the PGAM5-Drp1 axis as a crucial pathway of hepatocellular necrosis is fundamental to our understanding of the pathogenesis of human AIH and has profound therapeutic implications. Immunosuppressant application is currently the standard treatment of AIH with outcome remaining unsatisfactory1 Due to a lack of precise knowledge about cell death regulation in AIH, no treatment targets to block hepatic necrosis have been developed to date. Mdivi-1, an inhibitor blocking Drp1 activation, has been developed as a promising candidate for the treatment of diseases associated with excessive cell loss such as stroke, myocardial infarction and neurodegenerative diseases.12 In our study, we now demonstrate that Drp1-mediated mitochondrial fission is an early step in ConA-induced liver injury and potentially also relevant to human AIH. Importantly, treatment with Mdivi-1 inhibited hepatic necrosis and blocked liver injury in the experimental mouse model. Our findings therefore raise the interesting possibility that Mdivi-1 might have therapeutic properties by targeting hepatic necrosis in patients with AIH, particularly in cases refractory to immunosuppressive therapy.
Aside from Drp1 serine 616, phosphorylation of Drp1 at serine 637 has been shown to play an important role in inhibiting mitochondrial fission.30 ,31 Dephosphorylation at Ser637, such as by calcineurin, can reverse this inhibition. A previous study has demonstrated that PGAM5 can directly dephosphorylate Drp1 at Ser637 thereby activating its GTPase activity.7 IFN-γ is a major driver of ConA-induced liver injury.21 Interestingly, when using an in vitro model, IFN-γ-induced dephosphorylation of Drp1 at Ser637 and PGAM5 was required for this process (data not shown). The relation of PGAM5 and calcineurin in dephosphorylation of Drp1 at Ser637 is worthy of further investigation in the future. Moreover, although during apoptosis, mitochondrial fission may cause mitochondrial outer membrane permeabilisation,32 the downstream events and molecular pathways connecting Drp1-mediated mitochondrial fission to necrotic cell death remain to be determined.
In summary, our data uncover a crucial role for PGAM5-mediated necrosis in the pathogenesis of immune-mediated liver injury. Downstream of PGAM5, Drp1 mediates mitochondrial fission as a necessary step that drives the execution of hepatocyte necrosis and leads to liver injury. This has important clinical implications since Drp1-mediated mitochondrial fission is druggable. Future therapeutic strategies for AIH might benefit from targeting necrosis as an alternative or in combination with immunosuppression.
Acknowledgments
The authors thank G Förtsch, S Wallmüller, K Urbanova, H Dorner, A Taut, and C Lindner for excellent technical assistance.
References
Footnotes
G-WH and CG share first authorship.
Contributors G-WH, CG, SW and CB designed the research. G-WH, CG and V T performed the experiments. AEK, CP, KA, supplied material that made this study possible. G-WH, CG, MFN and CB analysed the data and wrote the paper.
Funding The research leading to these results has received funding from DFG projects within SFB1181 (C05) and the clinical research unit KFO257. Further support was given by the projects SPP1656, SFB796 (B09) BE3686/2, KR4391/1-1, by the Interdisciplinary Center for Clinical Research (IZKF) of the University Erlangen-Nürnberg and the European Community's 7th Framework Program (acronym BTCure).
Competing interests None declared.
Ethics approval Ethics Committee of the University Hospital Erlangen.
Provenance and peer review Not commissioned; externally peer reviewed.